Genetic Genealogy: Children of the Sun

In the night sky, the stars form patterns of mythical shapes and twisting outlines, like a jeweled crown of thorns, with points of Jupiter, Mars, Saturn, Sirius, and Venus.  As the stars and constellations move across the night sky’s darkness, the starry crown twists and turn and forms a ladder leading us into the depths of the heavens, from where all heavenly resources of earthly elements originated. Elements such as carbon, hydrogen, oxygen, nitrogen, and phosphorus, along with all that make life possible.  In return unites all of life with the heavens, the constellations, and the sun. These chemical elements are the bonds between earthly life and the rest of the universe. The formation of deoxyribose nucleic acid could not be possible without its heritage to the rest of the universe, the genesis, and the fabric of human, animal, and plant life.

Children of the Sun

We are the children of the light.
The crimson sun guides us.
Remember us, for we lived for beauty.
Remember us, for we lived for love.
Remember us, for we lived for originality.
As the light of time leaves us behind,
Remember us.

We are the children of the darkness.
The blue moonlight guides us.
Remember us, for we lived for discord.
Remember us, for we lived for hate.
Remember us, for we lived for revolution.
As the darkness of time leaves us behind,
Remember us. 

Children of the Sun © Richard Anthony Peña 

The Code of Life

The code of life begins with cells, the basic building blocks of all living things. The human body in its formality, composed of trillions of cells, provides a structure for the body, takes in nutrients, converts those nutrients into energy, and carries out specialized functions.  It is here, in the cells containing the body’s hereditary material, called DNA, or deoxyribonucleic acid, which is the hereditary chemical material in humans and almost all living organisms.  Most of all, DNA is located in the cell nucleus (nuclear DNA), but a small amount of DNA can also be found in the mitochondria (mitochondrial DNA or mtDNA).

The Cellular Structure

∃   Cytoplasm:  Within cells, the cytoplasm comprises a jelly-like fluid (called the cytosol) and other structures surrounding the nucleus.

∃   Cytoskeleton:  The cytoskeleton is a network of long fibers that make up the cell’s structural framework. The cytoskeleton has several critical functions, including determining cell shape, participating in cell division, and allowing cells to move. It also provides a track-like system that directs the movement of organelles and other substances within cells.

∃   Endoplasmic Reticulum (ER):  This organelle helps process molecules created by the cell. The endoplasmic reticulum also transports these molecules to their specific destinations inside or outside the cell.

∃   Golgi Apparatus:  The Golgi apparatus packages molecules processed by the endoplasmic reticulum to be transported out of the cell.

∃   Lysosomes and Peroxisomes:  These organelles are the recycling center of the cell. They digest foreign bacteria that invade the cell, rid it of toxic substances, and recycle worn-out cell components.

∃   Mitochondria:  Mitochondria are complex organelles that convert energy from food into a form the cell can use. They have their genetic material, separate from the DNA in the nucleus, and can make copies of themselves.

∃   Nucleus:  The nucleus serves as the cell’s command center, sending directions to the cell to grow, mature, divide, or die. It also houses DNA (deoxyribonucleic acid), the cell’s hereditary material. The nucleus is surrounded by a nuclear envelope membrane, which protects the DNA and separates the nucleus from the rest of the cell.

∃   Plasma Membrane:  The plasma membrane is the outer lining of the cell. It separates the cell from its environment and allows materials to enter and leave it.

∃   Ribosomes:  Ribosomes are organelles that process the cell’s genetic instructions to create proteins. These organelles can float freely in the cytoplasm or be connected to the endoplasmic reticulum (see above).

Sources:
i.) U.S. National Library of Medicine
ii.) The Genetic Science Learning Center at the University of Utah offers an interactive introduction to cells and their many functions.
iii.) Arizona State University’s “Ask a Biologist” describes and illustrates each of the cell’s organelles.
iv.) Queen Mary University of London allows you to explore a 3-D cell and its parts.
v.) The Biology Project: University of Arizona

DNA Structure:

Deoxyribose nucleic Acid consists of two parts; Deoxyribose is a ribose sugar without an oxygen element, and Nucleic Acid makes up the rest of the molecule. The DNA backbone is made up of a sugar (deoxyribose) phosphate, and the bases attach to the sugars and stick out almost at right angles into the center of the helix. The bases contain C, H, O, and N.

Double Helix Structure:

  • Right-handed Double Helix
  • Four bases which specifically base pair in a Watson and Crick formulation.
  • A–T (Adenine – Thymine always pair together)
  • G-C (Guanine – Cytosine always pair together)
  • There are two Purine bases (single rings) – A and G
  • There are two Pyrimidines (double rings) – T and C
  • The helix is the same width down (about 2 nanometers) due to Purines and Pyrimidines bases paring.
  • The DNA sequence lists the bases along either one of the two sides. For example, one side might read as T G T T C G T C, etc.
  • There are minor, and major grooves caused again by the different-sized bases. The major grooves allow enzymes to probe the bases and bind.

                         DNA Double Helix

A segment of DNA contains the code used to synthesize protein, and chromosomes contain hundreds to thousands of genes. Every human cell has 23 pairs of chromosomes, a total of 46.  Human traits are gene-determined characteristics often determined by more than one gene. Some traits are caused by abnormal genes, which are inherited or result from new mutations occurring during one’s lifetime.  Proteins are the most important class of biomolecules in the body. Proteins are the building blocks of muscles, connective tissues, skin, and other biological formations. Proteins also are needed to make enzymes.  Enzymes are complex proteins that carry out nearly all chemical processes and reactions within the body.  Your body produces tens of thousands of different kinds of enzymes, in which these types and amounts of proteins govern your entire body.  The synthesis of proteins is controlled by genes, which are contained in chromosomes.  An essential characteristic of DNA is that it can replicate or make copies of itself. Each strand of DNA in the double helix serves as a pattern for duplicating the sequence of bases. This is important when cells divide because each new cell needs to have an exact copy of the DNA present in the old cell.

Genetic Genealogy: Today, we are fortunate that the science of Genetic DNA has evolved into consumer-based testing, which is now more accessible and has opened up a new and growing field of genetic genealogy.  Genetic genealogy is the marriage of both traditional genealogy and genetic DNA findings.  One might say, “who cares” or “my family is so messed up, I don’t want to know,” but in time, you will.  At some point in your life, you will have more profound questions, why are you the way you are, or why was I born with these traits?  The sum of the DNA code and mutations that make you unique are the historical, biological markers and coded keys to your bloodline.  Your bloodline and pedigree are essential; they are the road map back into genealogical time, where your bloodline migrated from, and not only a genealogical map of your forebears but your relationship to the world you live in (who you are), and legacy to human history.

Traditional Genealogy: Genealogy is derived from the Greek word gena and logos (generation knowledge).  Genealogy is the study of generations of families through time or “genealogical time” with methods such as genealogical charts or family trees based on supporting documentation of family surnames, vital records, church records, and U.S. Census Records (1800-1940).  Traditional genealogy simply provides proof of your pedigree with legitimate and accepted records such as birth, and death certificates, church records, books, newspaper citations, or any accepted records. Nothing is more required than good and valid research. Genealogy alone is the most challenging puzzle to solve in that there are many sand traps along the way, such as surnames can change over time, confusion of birth names, out-of-wedlock births, adoptions, erroneous vital records, lost or destroyed records,  Y-DNA line termination, collapse the family tree, family lore verse facts, are indeed the most common challenges.

DNA Genealogy:  At the center of this discipline, there are three common types of tests regarding DNA Genealogy, Y-DNA, mtDNA, and Autosomal DNA.  Each test has a specific function. For example, Y-DNA tests are for your paternal line, which confirms your Father’s direct line (Father, Grandfather, Great Grandfather, GG Grandfather, and so on to your Adam).  mtDNA tests are for your maternal line, which is confirmation of your Mother’s direct line (Mother, Grandmother, Great Grandmother, GG Grandmother, and so on to your Eve). The Autosomal DNA test can match your DNA relatives, is reliable for up to four generations, and does not depend on one’s birth sex. With DNA Genealogy, there are broad to immediate to close family relationships.

One receives twenty-three pairs of chromosomes from one’s Father, twenty-three pairs of chromosomes from one’s Mother, or forty-six chromosomes from both parents. Twenty-two of the twenty-three pairs of chromosomes represent the Autosomal DNA.  The twenty-third pairs are the sex chromosome that delineates between females and males.  Females have two copies of the X-chromosomes, while males have one X and one Y chromosome.  With this said, remember that you will only inherit 50% of your parent’s Autosomal DNA, your parents only inherited 50% from their parents, and so on.  So the farther you go back in genealogical time, the percentage of inherited Autosomal DNA decreases from your ancestors; however, your direct Y-DNA and mtDNA will remain constant over genealogical time.  DNA testing alone is not absolute; like traditional genealogy, it can be tricky, as there is variability between labs, specimen quality, source references, and algorithms. Therefore, good, and valid paper research is necessary to go together with the DNA digital data.

DNA Testing Services

(Source: ISOGG)

Types of Genetic DNA Tests

The Family Tree:  Autosomal DNA (maternal and paternal DNA relatives, deep ethnicity)  Twenty-two of the twenty-three chromosome pairs represent the Autosomal  DNA.  The twenty-third pair is the sex chromosome that delineates between females and males. Females have two copies of the X-chromosomes, while males have one X and one Y chromosome.  Again, an important reminder; you inherit 50% of your parent’s Autosomal DNA, and your parents only inherited 50% of their parents, and so on.  So the farther you go back in genealogical time, the percentage of inherited Autosomal DNA decreases from your ancestors; your life is based on the probability of all who came before you.

Father’s Direct Line:  Y-DNA (12 markers, 25 markers, 37 markers, 67 markers, 111 markers)  The sample STR Results without SNP tests below illustrates how to interpret your DNA results on Y-DNA 12 Marker Test.  The values listed in fig. 1 Y-DNA 12 Marker Result represent each sequence on location on the Y-DNA chromosome.  Let’s take the location of DYS#426 based on the sequence below:

TGTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGAC…

As you can see from the DNA sequence above, there are 12 sets of GTT, and this value is counted under DYS# 426 in fig.1.  The same concept would apply to the 25, 37, 67, and 111 Y-DNA Markers Tests as well.  As a rule of thumb, the higher the Y-DNA Marker test, the more confidence is placed on the matches as a direct relationship to your paternal line.

Fig. 1 Y-DNA 12 Marker Result:

DYS#

393

390

19**

391

385a

385b

426

388

439

389-1

392

389-2

Alleles

12

24

14

11

11

14

12

12

13

13

13

29

**Also known as DYS#394

Mother’s Direct Line:  mtDNA (HVR1 and HVR2, Full Sequence)  The standard for mtDNA genome based on the Cambridge Reference Sequence (CRS). All the differences between your mtDNA and the CRS returned as the results. These results are predictive and used to estimate one’s mtDNA Haplogroup.  Roughly estimates the time individuals share a most recent common ancestor (MRCA).  The alphabet letter designation represents the Adenine, Thymine, Guanine, and Cytosine DNA codes.

HVR 1 DIFFERENCES FROM rCRS

16111T

16223T

16290T

16319A

16335G

16526

HVR 2 DIFFERENCES FROM rCRS

64T

73G

146C

153G

235G

263G

309.1C

315.1C

522-

523-

SNP Testing:  SNP (Single-nucleotide polymorphism) tests can reveal the changes in the single nucleotide within the DNA sequence.  Over time, the DNA makes copies of itself, which can result in errors known as mutation or polymorphisms.  SNP tests can determine a person’s exact haplogroup and subclades, if available, or one’s deep ancestry.

Haplogroups:   From the Greek word haploûs, one fold, single, simple. The definition a haplogroup is a genetic population group of people who share a common ancestor either on the patrilineal or matrilineal line. Haplogroups are assigned alphabet letters, and refinements consist of additional number and letter combinations to specific population sets.   Please keep in mind, that Haplogroups have very broad trees and branches of human migration over tens of thousands of years.  DNA and Y-SNP (single nucleotide polymorphism) testing can define the haplogroup you inherited from your mother and father.  The International Society of Genetic Genealogy (ISOGG) maintains current ongoing research of both Y-DNA and mtDNA haplogroups and subclades.

In some use cases, like Family Tree DNA’s Big Y Test can pinpoint one’s paternal haplogroup to a specific subclade, predictive region, and age.  My haplogroup example, R-Y23968, is a haplogroup estimated to be 4,200 (YBP) years before the present. This specific haplogroup R-Y23968, a subclade of R-DF27, originated in Europe, with an ancient specimen from Quedlinburg, Germany, from about 4246-4156 years ago, which tested positive for R-DF27.  The male population set specific to the Americas with Haplogroup R-D27 is generally thought of as an ancient Iberian group or subclade, which left Spain after 1492.

Y-DNA Human Migration (Haplogroups) – Source: FTDNA 
Thousands of Years Ago

A 60 G 20 O3 35
B 50 H 30 P 35
CT 50 I 25 Q 20
D 50 J 25 Q1a3a 10
E 50 K 40 R 30
E1b1a 20 L 30 R1a 10
E1b1b 20 M 10 R1b 25
C 50 N 10 S 10
F 45 O 35 T 10

mtDNA Human Migration (Haplogroups)  – Source: FTDNA 
Thousands of Years Ago

A 30 J 40 R 50
B 50 K 25 R0 30
C 20 L0 >100 T 20
D 25 L1 >100 U 50
F 50 L2 80 V 15
H 30 L3 70 W 20
HV 30 M 60 X 30
I 15 N 50 Z 30

DNA Tools: ISOGG Autosomal DNA_tools

#DNA*Genealogy


Credits and Sources:  Arizona State University, Blaine Bettinger (www.thegeneticgenealogist.com), Family Tree DNA (FTDNA), 23andme, Genetic Science Learning Center at the University of Utah, Queen Mary University of London , The International Society of Genetic Genealogy (ISOGG), University of Arizona, U.S. National Library of Medicine, National Institute of Health, Wikipedia

Rights Reserved  Genetic Genealogy – Children of the Sun © Richard Anthony Peña 2017

This entry was posted in 2016, Genealogy DNA and tagged , , , , , , , , , , , , . Bookmark the permalink.
error: Content is Copyright Protected!!