Oops! It appears that you have disabled your Javascript. In order for you to see this page as it is meant to appear, we ask that you please re-enable your Javascript!
  • Works on Paper and Piano

The Color of Three Stones: Gold, Lapi lazuli, and Marble


What such a glorious world made of light and shadows, luminous intensities, with shades of magnificence and wondrous color.  The colors of day transition from dawn to sunset, regardless of the day, yet more often or so, the observer takes such splendor as the normalcy of everydayness.  Be that as it may, such beauty of the hues of light and shadows have long been part of the human consciousness and observations from the very beginning of recorded history.  The experience of color is not only in the domain of the physical world, but the phenomena of color also exist in the ethereal human sub-consciousness and imagination.   Color is synthesized into the culture of color, and over the span of time, by the progression of science and technology.

O’ wondrous flame of fire and light, flickers tones of gold of the sun, blue of the heavens, and white of clouds, such bravura color mystifies the eyes but yet untouchable to hold.  The toil of imagination charges human hands to turn the earth below to behold gold, lapis lazuli, and marble for thou to hold!

The cave paintings of France and Spain are perhaps the earliest examples of human creativity and ingeniousness in finding materials that produce colors, and then incorporating the colors into a visual language to socialize the human experience. Such social adaptation has always been culturally at hand and practiced by human societies to the present day.  The subject of color can be subjective, objective, spiritual, or intellectual, and resides for those with most curious and thoughtful eyes.

One of the first notable color theorists was Leone Battista Alberti (b.1404 – d.1472), born in Genoa, Italy to a wealthy Florentine father.  His mother was unknown.  Alberti, well-educated, studied law as a profession but his interests in ancient ruins became his passion for forms, design, and architecture.  To underscore Alberti’s talents to only his contribution to Italian architecture would not do him justice as Alberti epitomized the Renaissance man, he was an artist, architect, cryptographer, humanist, linguist, mathematician, philosopher, poet, and writer.

By age twenty, Alberti’s developed a reputation as a writer, his first play, considered a piece of classical literature, and by age thirty-one, Alberti began his early major work Della Pittura, written in vernacular of the Italian Renaissance.  Della Pittura describes the figurative arts systematically through geometry and the theory of painting.  Alberti divided painting into three parts: Circumscriptio, Compositio, and Receptio luminum.  The noted renaissance historian, Giorgio Vasari (b.1511 – d.1574), chronicles Alberti’s life in Vasari’s Lives of the Most Excellent Painters, Sculptors, and Architects, published in 1550.

Of course, Vasari’s book also chronicles Leonardo Da Vinci (b.1452 – d.1519), artist, scientist, inventor, and writer.  Da Vinci’s Treatise on Painting covers color principles of light and shade, and takes an empirical approach to observation, recording his experiments how the color changes with the quality of light, effects of luminous bodies, tone, a reflection of color.  Besides, his investigations of color with the camera obscura, both of Alberti and Da Vinci contributions to color theory became the foundation and also the departure for some of the color theorists to come in the eighteenth, nineteenth, and twentieth centuries.

Between the late sixteen hundreds and early seventeen hundreds, Sir Isaac Newton (b.1642 – d.1726), began a series of experiments with the nature of light and color with Celebrated Phenomenon of Colours.  Newton’s experiments started with refracting white light with a prism, splitting it into its component colors: Red, Orange, Yellow, Green, Blue, and Violet.  He postulates that the source of color was light and that of white light when passed through a prism, creates a spectrum of colors observed by the human eye.  Newton viewed color as a system or wheel that contained the colors red, orange, yellow, green, blue, indigo, and violet, and in 1704 published the first color wheel, which he entitled Opticks.

In the early eighteen hundreds, Johann Wolfgang von Goethe (b.1749 – d.1832), arrived on the scene, Goethe, like Alberti spent time studying law, also lured away by the arts to become a notable writer by age twenty-five.  His works include epics, lyric poetry, dramas, memoirs, literary and aesthetic criticism, treatises on botany, anatomy, and of course color. His notable literary works include; Faust, The Sorrows of Young Werther, Wilhelm Meister’s Apprenticeship, Elective Affinities, Prometheus, Zur Farbenlehre, Italienische Reise, and West–östlicher Divan.  Also, nearly 3,000 drawings by him exist.

His 1,400-page treatise Theory of Colours published in 1810, considered a significant contribution and with moving color theory forward on two levels of perception and psychology of color.  The book canvasses detailed observations of phenomena such as colored shadows, refractions, and chromatic aberrations.  Although parts of Goethe’s work were indeed rejected by notable physicists, philosophers, and physicists, due to Goethe’s misinterpretation of Newton’s experiments, Goethe’s contribution lies with his way of characterizing physiological colors and subjective visual phenomena.

“When the eye sees a color it is immediately excited, and it is its nature, spontaneously and of necessity, at once to produce another, which with the original color, comprehends the whole chromatic scale.”

Goethe anticipates Ewald Hering’s (b.1834 – d.1918), opponent-color theory, by proposing a symmetric color wheel, which is one basis of our understanding of color vision today.

“The chromatic circle arranged in a general way according to the natural order for the colors diametrically opposed to each other in this diagram is those, which reciprocally evoke each other in the eye.  All intermediate gradations, reciprocally evoke each other, the simpler color demanding the compound, and vice versa.”

Goethe considered the Theory of Colours his most important work, which interesting to note, considering Goethe is far better known and credited for his literary works.  The Theory of Colours is a mediation of the dynamic interplay of light and darkness, and the Theory of Colours set the foundation for others, like philosophers Ludwig Wittgenstein (b.1889 – d. 1951),  and Arthur Schopenhauer (b.1788 – d.1860), who went on to develop his theory, On Vision and Colours.  Both Goethe and Schopenhauer theories on color became widely adopted by some in the art world, most notably, the British painter J. M. W. Turner (b.1775 – d.1851).

Albert Henry Munsell (b.1858 – d.1918), was an American painter of seascapes and portraits, art teacher, and inventor. Munsell attended and served on the faculty of Massachusetts Normal Art School in Boston where he lectured about Color Composition and Artistic Anatomy.  The school later became known as the Massachusetts College of Art and Design.  In 1905, Munsell published his first book, A Color Notation, which described his new color theory, followed in 1913 with his second book, Atlas of the Munsell Color System, and his third book in 1921, A Grammar of Color, published after his death.  All three of these books became the foundation for the Munsell Color Company formed in 1917.

Albert Henry Munsell and the Munsell Color System are still recognized today and best known for contributions in color science and color theory, which led to and became one of the first Color Systems, the Munsell Color System, which gained international acceptance, and served as the foundation for many other color systems, including CIELab color space.

The CIELAB color space, sometimes expressed as CIE L*a*b* is an international color space model as defined by International Commission on Illumination (CIE) 1976.  The CIE color spacial model represents color as three numerical values, L* = lightness, a* = Green-Red, and b* = Blue-Yellow.  The CIELAB is designed to model the perception of color with uniformity to human color perception, in that a change in the CIELab model corresponds to about the same amount of visually perceived shift in tone.

The CIELab space in itself, a three-dimensional real numerical space, allowing an infinite number of representations of colors. The L*, a*, and b* values are considered absolute, L*, the lightness value, represents the darkest black at L* = 0, and the brightest white at L* = 100.  The color channels, a* and b*, neutral gray values are at a* = 0 and b* = 0, while the a* axis represents the green–red channel, green is in the negative direction and red in the positive direction. The b* axis represents the blue-yellow channel, with blue in the negative direction and yellow in the positive direction.

The CIELAB color space is typically utilized to convert from RGB (Red, Green, and Blue) to CMYK (Cyan, Magenta, Yellow, and Black).  The CIELAB gamut includes both the ranges of the RGB and CMYK color models commonly used in graphic communications, photography and other color applications may they be scientific or artistic.

Scientifically what we know about color today is of a practical science of color, but there is an unknown region of color science that only physics and mathematics can observe and measure the complex frequencies of the electromagnetic field which holds all that seen and unseen.  The history and progression of color theory within the science of color resemble much like a winding road with switchbacks, bottlenecks, and road markers, at times the road has been traveled by the curious and the intellectually interested, but the way has always been laid down by the purveyors of color.

The Purveyors of the Color Gold

The scientific consensus of the origins of Gold; Symbol Au and Atomic Number 79, is based on the scientific construct of supernova nucleosynthesis, the result of two neutron stars colliding together causing a mass explosion pushing heavy metals (Gold and Platinum) into the universe.  Through this mass explosion, gold becomes present in this stardust mixture of elements which form the heavenly bodies, the solar system, and our world.

During the Precambrian time (4.5 billion years ago), a period starting from our planet’s creation and ending with the beginning of the emergence of sophisticated multi-celled life forms four billion years later, and throughout this period the earth was molten.  Heavy metals such as gold sank closer to the planet’s core, along with asteroid impacts introducing gold and other elements into mantle and crust.

The color of the sun and its golden rays have evermore painted the imagination of humans throughout the ages, from the Far East to the West, such mythologies of Pixiu, Hiranyagarbha, and Midas, are more than cultural examples that have embodied the psyche and psychological impact on what we call the culture of color.  In many ways, the humanity of antiquity with their vivid imagination of gold’s relationship to the sun is mystifying as it is instinctively true.

Perhaps, the best well-known Western classical mythology about gold is the legend of the Golden Fleece or the Ram with a Golden Fleece. The story is of great antiquity and was current in the time of Homer, and like all great stories, it survives in various forms, among which the details vary.  Some think perhaps the story of Golden Fleece may have been conjured up when the use of fleeces was used to trap gold dust from placer deposits in the ancient world.

In the Golden Fleece, the hero Jason and along with his band of Argonauts set out on a journey and quest for the Golden Fleece and Jason’s right to the throne.  This supernatural tale has many moral implications by today’s standards, with imaginative twists and turns, but is ultimately is a story which symbolizes the golden attribute of the ram’s fleece as a representation of authority and power.

Historians are not sure when gold first appeared in cultures of antiquities, but the literary findings indicate gold was present in the Levant and the Balkans regions.  The topic of gold is mentioned in the Old Testament, starting with Genesis 2:11 in the land of Havilah, also in Exodus  32:1-6 with the story of the Golden Calf and gold can be found in many parts of the temple including the Menorah and the golden altar.  In the New Testament, the magi bring the gift of gold as cited in the chapters of Matthew, and in the Book of Revelation 21:21 describes the city of the New Jerusalem as having streets “made of pure gold, clear as crystal.”

The exploitation of gold in the southeast region of the Black Sea dating from the time of Midas which gold became a vital commodity in the establishment of what is likely the world’s earliest coinage in Lydia around 610 BC.  During the 6th or 5th century BC under the Zhou Dynasty, the commodity of gold in the Chu state circulated the Ying Yuan, one of a kind square gold coin.

The Romans developed new metallurgy methods for extracting gold on a large scale by introducing hydraulic mining methods, especially in Hispania (Spain) from 25 BC onwards and in Dacia (Carpathian Mountains Regions and States) from 106 AD onwards.  One of the Roman’s largest mines was at Las Medulas in León, the Romans used seven long aqueducts and enabled the aqueducts to alluvial process most, if not all, of the large gold deposits.  The Roman empire also had extensive gold mines in the Roşia Montană in Transylvania and smaller mines around the empire as described by Pliny, the Elder in his encyclopedia Naturalis Historia written towards the end of the first century AD.

The ancient Egyptians were among to embraced and harnessed gold in their civilization. The first written findings referencing gold was in the 12th Dynasty of Ancient Egypt (1900 BC).  The oldest map of a gold mine recorded was in the 19th Dynasty of Ancient Egypt (1320–1200 BC).  King Tushratta of Mitanni claimed gold, “more plentiful than dirt” in Egypt, based on Egyptian hieroglyphs from as early as 2600 BC.

In Saqqara Egypt, it was the Grand Vizier by the name of Mereruka who was in charge of the royal tombs, production, and protection of Egypt’s gold, and perhaps the most powerful Egyptian official outside of the king.  If the Egyptian mystique was not enough, the Grand Vizier Mereruka only employed dwarfs as goldsmiths to work in the gold mines because the Egyptians believed they possess magical powers.

Later in the twentieth century, it was British archaeologist and Egyptologist Howard Carter (b. 1874 –  d.1939), who became world-famous after discovering the tomb of the 18th Dynasty Pharaoh, Tutankhamun (KV62), in November 1922.  The solid gold death mask of Tutankhamun became the iconic and emblematic face of ancient Egyptian civilization.

In the beginning, early Christian theology embraced the poor, the oppressed, and the persecuted.  As Christianity evolved, the Christian patriarchs in the Roman-Byzantine period understood what the Greeks understood before them, that narratives become more powerful when presented in both two and three-dimensional forms, such as painting, mosaics, sculptures, architecture, to overcome the plague of illiteracy of the uneducated populous.  As for an image could tell a story, convey and connect multiple narratives without the written words, and could be passed on through the oral tradition and the socialization of the culture.

In Christianity, the power and bounty of both the image and word of the gospel coupled together as one and thrived from the Byzantine period through the early and high Renaissance and on to the Baroque period.  Literacy of religious iconology was well understood by the masses and high born by this time.  During this period between 476 AD  to 1750, color was the metadata code linking back to the spiritual source code of the gospel.  The color of gold replaced white as the symbolic light of God with all its splendor and glory of the Byzantine period.

As legend has it when Vladimir the Great, (c.959 – 1015), Grand Prince of Kiev and ruler of the Kievan Rus, observed and understood how religion played a role with the ruling powers in the West.  As the legend and history go, the prince decided to go shopping for religion to unify his people under one governance and religion, and this would allow him to move his people away from the shadows of Russian pagan forests now that the Mongols’ terror faded away with the winds of history.

Vladimir looked at the religions of the Mideast but thought some of the practices were too restrictive.  When his ambassadors set their eyes inside the Great Cathedral of Hagia Sophia in Constantinople, the light reflecting off the gold-laden mosaic images of Christian religious icons made such an impression.  His ambassadors described their experience to the prince, “We knew not whether we were in heaven or on earth, for surely there is no such splendor or beauty anywhere upon the earth.”  It was this point in history where Russia adopted Eastern Orthodox Christianity partly influenced by one color, the splendor of gold.

During the Renaissance, the color and the substance of gold lured the wealthy and ruling elite of Europe.  The epic center of goldsmithing was Renaissance Florence, and here comes Benvenuto Cellini (b.1500 – d. 1571),  perhaps, the most celebrated goldsmith ever.  Cellini, like many of the artists of the Renaissance, was skilled in more than one art, he was a sculptor, draftsman, musician, and artist who also authored an autobiography and poetry.

The works of Perseus with the Head of Medusa and the Salt Cellar are indeed two of Cellini’s most outstanding and beautiful masterpieces in the world of art.  The Salt Cellar commissioned by the King Francis I of France is a masterful work of goldsmithing with the two golden figures juxtaposed each other, Neptune, the god of the sea and Tellus the goddess of the earth.

As brilliant Cellini was at his art, he was a just as spirited in being morally corrupt and a dark figure, led a life full of brawls, feuds, and with more than one accusations of buggery to his reputation.  Cellini confessed to three murders, enjoyed using his arms perpetrate murder, imprisoned several times, but in the end, it was the color of gold and his art that saved him from a far more deleterious fate.

All that glitters is not gold but that is not the case with gold nanoparticles that are at the center of advanced medical technologies such as Rapid Diagnostic Tests (RDTs) in which collected blood specimens, and RDTs are used globally to detect such diseases as HIV, influenza, strep, and endemic-malaria.  Rapid Diagnostic Tests are considered critically important in medical technology and has changed disease diagnosis in the developing world over the last decade.

Research with gold nanoparticles around the world is bringing into light new medical innovations with diagnosis technologies, gold-based drugs, and treatments for some of the world’s most chronic diseases. Gold is also part of the physiology of humans, in the technical treatise entitled, The Elements, Third Edition, written by John Emsley and published by the Clarendon Press, Oxford in 1998, the average person’s body weighing 70 kilograms (154.3 lbs.) would contain a total mass of 0.2 milligrams of gold.

In comparison to the other elements based on the average weight, the human body contains 43 kilograms (93.4 lbs.) of oxygen, the most abundant element in the earth, as well as the human body. Other elements found in the human body include 16 kilograms (35.2 lbs.) of carbon and 7 kilograms (15.4 lbs.) of hydrogen. While the role of gold in the physical processes of the human body has been unknown for many years, recent research has determined that gold plays a role in both the health and maintenance of the joints, as well as crucial element in the transmittal of electrical signals throughout the human body.  The color of gold can heal and at times save souls from fate, but links us historically, mythologically, and scientifically back to the Sol (G2V).

The Purveyors of the Color Blue

During the period of Egyptian antiquity, the Egyptians held the blueness of the sky and heavens in the highest regard, for blue was considered the pure color of the heavens and beyond.  To the ancient Egyptians, the color symbolized life itself, fertility, rebirth, and water.  The pigment, Egyptian blue (calcium copper silicate) used by the Egyptians and for thousands of years became one of the first synthetic or artificial pigments used by man.

The Romans called it caeruleus (Latin caelum, “sky” or cerulean, “sky blue”), and the English name “Egyptian blue” was not adopted until 1809.  The oldest Egyptian blue artifact found is said to be about 5000 years old, located in a tomb painting dated to the reign of Ka-Sen, the last pharaoh of the First Dynasty. Egyptian blue became widely used during the Egyptian period to the end of the Roman era.  Eventually, Egyptian blue was later replaced by Lapis lazuli as the pure and sacred blue of the heavens.

Lapis lazuli or lapis is a deep blue stone used since antiquity for its intense color of blue.  As early as the 6th millennium BCE, lapis lazuli mining began in northeast Afghanistan.  The stone was highly valued by the Indus Valley Civilisation (3300–1900 BCE) which included an area from northeast Afganistan to Pakistan. Lapis artifacts such as beads were found in Neolithic burials and later used in the funeral mask of Tutankhamun (1341–1323 BCE).

Near the end of the Middle Ages, the export of lapis lazuli to Europe began, and the Afghanistan lapis lazuli trade into Europe started with Italian traders during the 14th and 15th centuries.  Venetian traders exchanged gold for lapis lazuli for its decorative qualities but more critical was the growing demand for lapis lazuli as a desired pigment became an essential global commodity; in that Lapis lazuli was considered more precious than gold.  Lapis lazuli pigment introduced a new word into the language known as ultramarine or the original name in Latin, ultramarinus means “beyond the sea” refers to where the pigment was from across-the-seas from Afghanistan.

To make ultramarine, the Italian artist, and craftsman, Cennino d’Andrea Cennini (c.1360 – abt.1427), provided instructions on how to prepare  ultramarine pigment in his Book of Arts. The process of extraction involved grinding the lapis lazuli stone into a very fine powder, infusing the deposits with melted wax, oils, and pine resin to rid of the impurities, and then kneading the product in a dilute lye solution resulting in pigment.

During the Renaissance, ultramarine blue became an expensive commodity, the color of blue, traditionally reserved for depicting clothing of the central figures, like the raiment of Christ, angels or the Blessed Virgin Mary.  Ultramarine blue became desirable by some of the most important artists of the Renaissance and Baroque, including Masaccio (b.1401 – d.1428), Pietro Perugino Vannucci (c.1446 – d.1523), Titian or Tiziano Vecelli (C. 1488 – d.1576), and Johannes Vermeer (b.1632 – d.1675).

Ultramarine was considered the finest and most expensive of all blue pigments, European painters depended on wealthy patrons to underwrite their purchases.  The rise in the cost of the pigment mainly caused by the restrictions and controlling interests of the Church to codify the ultramarine blue as holiness and humility.

The blue pigment is indeed storied, Michelangelo (b.1475 – d.1564) left his painting, The Entombment (1500–1501) unfinished because he could not generate the funds to buy ultramarine blue pigment.  Raphael (b.1483 – d.1520), used the pigment so scarcely to conserve his funds, and Johannes Vermeer (b.1632 – d.1675), used it so much, that his indulgence for ultramarine blue pushed his family into debt.

Given the high demand and cost, it was not until 1824, France’s Societé d’Encouragement offered a reward of 6,000 francs to anyone who could invent a new alternative of ultramarine. Alas! Both a French chemist and German professor both derived at a new synthetic formula within weeks of one another.  Indeed the competition contested.  The new pigment was named “French Ultramarine” which should come to no surprise considering the sponsor of the contest.

Pablo Ruiz Picasso, (b.1881 – d.1973), one cannot speak about Pablo Picasso’s life without mentioning the Picasso Blue Period paintings, which occurred between 1901 and 1904 in Barcelona and Paris.  The paintings are a sober and melancholy cast of destitute characters but striking, emblematic, and memorable like the “Old Guitarist” (1903), or “La Vie” (1903), or “La Célestine” (1904).     

Picasso once suggested the blue paintings began around 1901 after learning the news of the death of his best friend, Carles Casagamas (b.1880 – d.1901), son of the American Consul General stationed in Barcelona.  Casagamas was a year older than Picasso, and a painter and poet, which Picasso considered Casagamas, his close friend, both in their early twenties enjoyed the male comradery of drinking and socializing with women.  In the autumn of 1900, Casagamas accompanied Picasso to visit the World’s Fair in Paris, and there Casagamas fell in love with Laure Gargallo, known as Germaine.

Germaine in time spurned Casagamas’s love, and in his despair, Casagemas committed suicide on February 17, 1901, after first attempting to kill Germaine and believing she was dead.  Picasso was deeply affected by Casagamas’s death, and in many ways Picasso internalized the grieving of Casagamas’s death, which changed his behavior and mannerism and painting style.  He later returned to Paris in May 1901, oddly enough he took up residence in Casagemas’s former apartment and began a relationship with Germaine.  In the Spring of 1901, the youthful and lively world of Picasso became a bit somber and melancholy with the realities of human mortality, and in return, Picasso gave the world something blue to ponder.

Yves Klein (b.1928 – d.1962), French artist and a prominent figure in post-war European art who made the color blue his brand, also a leading member of the Nouveau réalisme in the 60s started by art critic Pierre Restany.  Klein experimented with performance art and perceived as an inspiration to minimal art and pop art.

In 1962, Yves Klein introduced his new blue monochromatic painting which was an innovation created with a unique patented color named Klein International Blue, which was a pigment variation with ultramarine blue.  In the early 1960s, the introduction of Field Painting that was the rage, and not so much the Action Painting of the 1950s.  Klein’s field paintings with this new blue reminiscent of the lapis lazuli used to paint Madonna’s robes in Renaissance paintings, now become another expression of spirituality, a gateway to the beyond, into the heavens, the ultimate freedom from human despair and transgressions.

The historical significance of the color blue with the past, in part, is well documented, and what we can learn from antiquity, blue is a code for the earth, the spiritual, sacred, holy mother, the ethereal emotions of grieving, and otherworldliness. Whoever adorns blue, upholds the spiritual significance of the color, and honors their mothers, sisters, wives, and daughters, for women, are the caretakers and birth gateway of life.  Somewhere between the paradox of birth and death our life experiences are sometimes mysterious, ephemeral, and spiritual as the blue moonlight that shades the nightly landscape, and from a distance, afar, the earth is nothing more than blueness in the line of sight in the vastness of space.

The Purveyors of the Color White

Before white, as color became a series of marks in historical time, white of a paler shade appeared as magnificent, bountiful, and towering white clouds cross the stark blue skyline and inspired thoughts of beauty, imagination, and personification of human-inspired Hellenistic gods in the form of the whitest marble.  The ancient Greek bedrock of Western European culture in all its glory was, indeed, built upon with the whitest marble and at times, painted to reflect the sensibilities of the times.

The word marble comes from the Ancient Greek word mármaros meaning “crystalline rock” or “shining stone.”  Parian marble which is pure white fine-grained and Pentelic marble which is also pure white fine-grained but semitranslucent, both are the finest of Greek marble.  Technically speaking, marble is a metamorphic rock or a rock that has been changed by heat, pressure or chemical processes of metamorphism. Marble is composed primarily of the mineral calcite (CaCO3), and of course consists of other minerals, such as clay minerals, micas, quartz, pyrite, iron oxides, and graphite. When metamorphism occurs, the calcite in the limestone recrystallizes to form a rock that is a mass of interlocking calcite crystals.

The ancient Greeks could take the imaginative figures formed by the shape of the clouds and transformed white marble into legends of Laocoön and His SonsThe Winged Victory of Samothrace, The Venus de Milo, and the Elgin Marbles.  The ancient marble architecture of Athens with the likes of the Parthenon, Acropolis site, and Greek temples became the model and foundation of Western European institutions, emblematic of democracy, justice, intellectual discourse, and theater.

Of course, the ancient Greeks did not know how their culture, arts, and architecture would impact thousands and thousands of years into the future, nor did they know that such a color as pure and pristine as white, could be so easily corruptible by the few.  For the past has an inexplicable way to influence the future, the connection of generational values from one generation to another may ebb and flow or even mutate with newer values going forward in time.  The Roman, Renaissance, and Neo-classical periods are a few examples where retreaded cultural values became touchpoints back to classical antiquity or nostalgic periods in historical time.

Johann Joachim Winckelmann (b.1717 – d.1768), a German art historian and archaeologist during the 1700s, considered by many a pioneering Hellenist and father of modern archaeology; who articulated the differentiation between Greek, Greco-Roman, and Roman art.  Winckelmann’s Masterwork, Geschichte der Kunst des Alterthums (The History of Art in Antiquity) published in 1764, became a significant contribution to the rise of the neoclassical movement.

The History of Art in Antiquity is recognized as a permanent part of the cultural record of European literature and considered a comprehensive and chronological account of all art of antiquity.  Winckelmann sets forth the virtues of ancient Greece in which he asserts the notion of imitation of such greatness of the Greek antiquity, will lead to high art.  His literary accomplishments in art history made him not only a thought leader of his time but single-handily ignited the neoclassical period.

Therefore, Winckelmann’s writings were the apparent force that brought social change to European culture and put white marble on a pedestal as the color of purity and idealism of Classical antiquity. The impact of Winckelmann’s influence on European art, is indeed a profound one, and artists as the likes of Anton Raphael Mengs (b.1728 – d.1779), Jacques-Louis David (b.1748 – d.1825), and there was also Josiah Wedgwood (b.1730 – d.1795), who also became a very successful practitioner of neoclassical movement and made his mark with the color of white.

Josiah Wedgwood (b.1730 – d.1795), of the renowned Wedgwood family of ceramic pottery fame, inventor, and entrepreneur.  Josiah Wedgwood inherited his family business and credited with industrializing the manufacturing of ceramic ware and pottery and turned the business into an internationally recognized brand of ceramics known as Wedgwood.

The Wedgwoods were Unitarians and socially progressive family, politically aligned with the values of the Enlightenment and active in the Lunar Society of Birmingham. Wedgwood also was a prominent Abolitionist and remembered for “Am I Not a Man and a Brother?” anti-slavery medallion; promoting the cause of justice, humanity, and freedom.

Wedgwood was not only a brilliant marketer, pioneered direct mail, money back-guarantees, buy-one-get-one-free, and catalogs but also possessed an empirical mind when it came to the formulary of ceramics and glazes.  He carried out thousands of experiments to determine which chemicals and processes were needed to produce a range of colors.  His Experiment Book ledgers contained thousands of glazed experiments and noted in the book his quest for the perfect white glaze for the production of “Creamware” and “Pearlware.”

Now, with the right formulation of creamware in hand, Josiah Wedgwood presented the English nobility classes with serviceable earthenware of exquisite beauty.  Wedgwood realized there was more to be done with his brilliant strategy, Wedgwood then sought and was successful in obtaining  Queen Charlotte of Mecklenburg-Strelitz  (b.1744 – d.1818),  permission to use her title in the new brand of earthenware. This concurrence allowed Wedgwood to carry out his most ambitious brand of Queen’s Ware, a brilliant white useful service earthenware that was affordable to the English classes with a brand that the English people could associate and identify as English.

When one thinks of all the technological triumphs that history has bestowed on humankind, Wedgewood’s Queen’s ware necessarily does not come to mind so quickly, but there is indeed, a more brilliant and overlooked narrative behind Wedgwood’s success in the line of sight of history.   Perhaps, history is not always what it seems because the charged recollections of the past are either forgotten or conveniently forgotten depending on the given perspective.

Consequently, the next statements may sound strange to some in that Josiah Wedgwood with his Queen’s earthenware and glaze that could produce the brilliant color of white change the course of the human condition, forever.  Wedgwood’s introduction of an affordable service earthenware into the market expanded the earthenware market with more competition, not to mention China trade.  As a result, the service earthenware became very affordable for all economic classes.

We are beholden to Wedgwood’s brilliance; elevated the quality of life for all economic classes, consequent to the Industrial Revolution, by eliminating the economic convention and practice of eating from wooden trenchers, coarse and poor quality pottery, dishes made of pewter, all dangerously unsanitary and associated with health risks plaguing humanity.  Wedgwood gave us all this wrapped in a color pure as white.

Charles-Édouard Jeanneret (b.1887 – d.1965),  also known as Le Corbusier, a pseudonym adopted in 1920.  Le Corbusier was an architect, designer, painter, urban planner, and writer. Le Corbusier pioneered modern architecture. Born in Switzerland but became a French citizen in 1930.  During Le Corbusier’s fifty year career he designed buildings in Europe, Japan, India, North America, and South America.

In many ways, Le Corbusier was more than an architect and was on the cusp of global urban planning, dedicated to providing better global living conditions for the residents of crowded cities around the world.  Le Corbusier was one of the founding members of the Congrès International d’Architecture Moderne (CIAM).  Prepared the master plan for the city of Chandigarh in India, and contributed specific designs for several buildings.  As recent as 2016, the UNESCO World Heritage registered seventeen projects by Le Corbusier in seven countries as, The Architectural Work of Le Corbusier- Outstanding Contribution to the Modern Movement.

Le Corbusier’s father was an artisan who worked with enameled boxes and watches. His mother provided music lessons, she gave piano lessons, and his elder brother was an amateur violinist. Le Corbusier was attracted to the visual arts as a teenager and attended the municipal art school in La-Chaux-de-Fonds, and there he studied applied arts with watchmaking. Later, Le Corbusier participated at a higher level course with the painter, Charles L’Eplattenier (b.1874 – d.1946).

While in the Art School, Le Corbusier studied with the architect René Chapallaz (b.1881 – d.1976), who said to have had an influence on Le Corbusier’s earliest house designs, however, it was Le Corbusier who noted in Jean Petit’s book, Le Corbusier: Lui-même (1970), that it was the art teacher L’Eplattenier who made him choose architecture.  The change in study ushered in Le Corbusier’s new found interest in architecture, but like many of his contemporaries, Frank Lloyd Wright (b.1867 – d.1959), and Mies van der Rohe (b.1886 – d.1969), Le Corbusier did not have formal academic and rigorous training as an architect.

Le Corbusier took the time afforded him to incubate his interest in architecture by spending time in the library to research architecture and philosophy, visiting museums, sketching buildings, and by constructing architectural mock-ups.  In 1905, under the direction of René Chapallaz, Le Corbusier and two other students worked on their first residential design, the Villa Fallet, a large chalet with a steep roof in the Swiss alpine style and crafted with colored geometric patterns on the façade. The residential design was a success which led to the construction of the Villas Jacquemet and Villas Stotzer near the same site.

In the autumn of 1907, Le Corbusier traveled to Italy, then on to Budapest to Vienna, and met painter Gustav Klimt (b.1872 -d.1918).  During the time Le Corbusier time spent in Florence, he was impressed by the Florence Charterhouse in Galluzzo, a Carthusian monastery founded in 1341 by the Florentine noble Niccolò Acciaioli (b.1310 – d.1365), Grand Seneschal of the Kingdom of Naples.  The Charterhouse left an impression, a charged recollection, an idea touchpoint of a unique kind of residence and living which influenced some of his architectural designs.

Between 1908 and 1910, Le Corbusier moved to Paris and worked as a draftsman in the office of the architect Auguste Perret (b.1874 – d.1954).  Perret, noted for his pioneering use of reinforced concrete in residential construction and the principal architect of the Paris Art Deco landmark, Théâtre des Champs-Élysées, Church of Notre-Dame du Raincy, and the French Economic, Social, and Environmental Council building, to name a few.

Le Corbusier sought the road in search of knowledge, and traveled to Germany between October 1910 and March 1911,  during tenure in Germany he found employment with Peter Behrens (b.1868 – d.1940), a German architect and designer, relevant to the modernist movement, and several of the movement’s leading names among Le Corbusier included Ludwig Mies van der Rohe (b.1886 – d.1969) and Walter Gropius (b.1883 – d.1969).

Later in 1911, journeyed to the Balkans, Serbia, Bulgaria, Turkey, Greece, Pompeii, and Rome, fulfilling his creative drive, produced nearly 80 sketchbooks with renderings of what he saw including many sketches of the Parthenon, forms of classical antiquity, where he would later praise in his book, Towards an Architecture, 1923.   It was not uncommon for Le Corbusier to write about his trips, Le Voyage d’Orient and Le Voyage d’Orient Carnets are good examples of Le Corbusier’s creative thoughts and sketches, not to mention many of his published essays, articles, and books.

In 1917, Le Corbusier met the painter Amedée Ozenfant (b.1886 – d.1966), and together they collaborated on many projects,  books, paintings, and color theory.  They published the Doctrines of Purism in their book, Après Le Cubisme, 1917.  They collaborated between on the Journal L’Esprit Nouveau, published from 1920 to 1925, and during their eight-year tenure of collaboration, they developed and defined a purist color theory, which included principles and guidance, as well as the strict color palette dedicated to purism as a creative axiom.

Together they presented the relationship between color and form;  The idea of form has priority over the idea of the color.  Ozenfant and Le Corbusier insisted on a reduced palette based on the advancing and receding properties of color hues.  They believed these defined color concepts are pertinent to purism as constructive art and architecture.

“Color is a perilous agent in the expression of volume; very often it destroys or disorganizes volume because the intrinsic properties of color differ greatly: some are radiant and push forward, others recede, and still others are massive and stay in the real plane of the canvas, etc. (Ozenfant and Jeanneret 1921).”

Ozenfant and Le Corbusier ‘s article Le Purisme a treatise on color:  Three hierarchically ordered color gammes (groups) based on the different spatial properties of each shade.

1.) Grande Gamme: Major group hierarchically, made up of yellow and red ochres, earth tones, white, black, ultramarine blue and of course certain shades derived from them by mixing.

2.) Gamme Dynamique: Dynamic group, lemon yellows, oranges (chromium and cadmium), vermilions, Veronese green, light cobalt blues

3.) Gamme de Transition: Transitional group, the madder reds, emerald green, all the lacquer colors.

Ozenfant and Le Corbusier believed each of these groups characterizes a spatial property based on the visual effect of color on human experience.  This idea became repurposed later for the basis for Le Corbusier’s Architectural Polychromy ideas in the 1930s.  Le Corbusier created a swatch book of colors for Salubra, a Swiss wallpaper company, and in his color swatch book, published in 1931, Le Corbusier organized the color palette (43 different colors and 20 more colors in 1956) like a keyboard; a cardboard cutout is utilized to associate color harmonies.

Le Corbusier’s Color Ideas:

1.) Create the atmosphere or ambiance using color.

2.) Contrast achieved by applying synthetic pigments.

3.) Transparent synthetic pigments alter surfaces without affecting how the eye perceives space.

The love and rule of Ripolin, in 1925, Le Corbusier published his book, L’art decorative d’aujourd’hui, which includes the section for Le Corbusier’s Law of Ripolin (Le Lait de Chaux – La Loi du Ripolin), an enthusiastic law based on Le Corbusier’s creative and emotional temperament.  The Law of Ripolin states to whitewash all buildings and to replacing the architectural interiors with a coat of white Ripolin.

For Le Corbusier, the color white symbolizes the cleansing of space, the removal of all non-essential items, as a moral and spiritual act of self-renewal. Whitewashing the architectural exterior has its roots in European culture, but with Le Corbusier’s architectural vision the color white becomes a bifurcated statement; as the color white in Le Corbusier’s eyes becomes a societal and aesthetic statement.

The pure and gleaming white represents the renewal of a society with traditional values, urban structures balanced with social infrastructures creating a harmonic culture for the humanity of the cities. The color white becomes a metaphor for social morality, integrity, pureness, and the incarnation of all things of aesthetic virtue. White also serves to enhance the reading of the architectural volumes when color is applied.  Although, it appears Le Corbusier was only a practitioner of a monochromatic white vision but that is not entirely true, as his use of color was precise and with a sense of purpose, but sometimes our memory is like a photograph, and we take with us the dominant color of white of his architectural works.

Villa Jeanneret-Perret – 1912 (Residential)

Maison Guiette/Les Peupliers – 1926 (Residential)

Villas at Weissenhof Estate – 1927 (Residential)

Villa Savoye – 1928 (Residential)

Palace of Ministry of National Education and Public Health – 1936 (Public)

Chapelle Notre Dame du Haut – 1950 (Public)

Le Corbusier, the purist in more ways than one, sometimes with hot white luminosity and sometimes shaded to his discredit, confident in his belief in rules and dogmas of architecture, the visual arts, he possessed an eccentric mannerism and interest in his sense of design and order.  What Le Corbusier derived from the symbolic nature of the color white transforms into an innate sense of the order and quality of all things must have, which also includes to varying degrees his ideas of social-political order and urban planning, both are of interest and reflection of human societies.

At times his strict belief in the purity of design would lend itself to a corrupt naivety.  Le Corbusier would engage with totalitarian regimes, the years spent in the Soviet Union under Stalin, attempting to assist Benito Mussolini by offering his services in urban planning in North Africa are examples of his propensity for a totalitarian society, where social order is paramount, the color of white becomes appropriated and then corrupted by the few.

Benito Amilcare Andrea Mussolini (b.1883 – d.1945),  political journalist and politician who turned into one of the twentieth century’s notorious and brutal dictators,  a protégé of Adolf Hitler, (b.1889 – d.1945).  Mussolini first led Italy constitutionally until 1925, then turned political directions and established a dictatorship.  In years before becoming a dictator, Mussolini had been a socialist but was expelled from the party for going against the party stance of neutrality during World War I.   Mussolini enlisted into the Royal Italian Army and served in World War I until he was wounded and discharged in 1917.   After the war, Mussolini changed his politics direction changed from socialism to nationalism, afterward to the fascist movement.

Mussolini became the leader of the National Fascist Party (Partito Nazionale Fascista, PNF), and became known as Il Duce “The Leader” in the party by name.  Mussolini was credited as the founder of Italian Fascism and ruled Italy as Prime Minister from 1922 to 1943.  It did not take Mussolini long, and within five years, Mussolini and his followers had established dictatorial authority by both legal and extraordinary steps to create a totalitarian state by through a series of laws that transformed Italy into a one-party dictatorship. In 1943, King Victor Emmanuel III (b.1869 – d.1947), deposed of Mussolini but months later Mussolini returned as leader of the Italian Social Republic, an Axis power client regime in northern Italy.  Mussolini held this political post until his demise and death in 1945.

The rise of totalitarian rule under Mussolini’s was not by any means, incidental, but by a well thought out and calculated approach, which included uses of brutality in the Italian homeland and horrific brutality and racism in North Africa.  Mussolini and his followers captured the minds and hearts of the Italian nation by the use of propaganda and with nationalistic optics.  The Mussolini regime focused on creating a copious cult of personality imagery centered on the figure of Mussolini, a leader fueled by machismo and with quasi-divine capacities where at times he would take over and control the different ministries of his government based on his political preferences.  Also, the Mussolini regime spent lavish sums of money on high profile public works and international prestige propaganda projects with the likes of the Blue Riband Ocean liner SS Rex, Macchi M.C.72, and the Italo Balbo.

Mussolini and his regime were also adept at using architecture work projects as propaganda, later became better known as Italian Fascist Architecture with its revisionist past to the Roman Empire.  Sometimes the Roman fasces emblem (bundle of the sticks with an ax) could be in plain sight on the public buildings and places and where the political brand fascist was derived.  The high profile fascist architecture built during the Mussolini era had a striking white appearance which dominated the urban sites and boulevards of Fascist Italy, reminiscent of white marble and buildings of the Roman past:

Palazzo Della Civiltà Italiana (1943)
Palazzo dei Congressi (1942)
Palazzo delle Poste di Palermo (1934)
Palazzo Braschi in Rome, headquarters of the Fascist Party Federation (1934)
Milano Centrale (1931)
Mussolini Dux on Obelisk (1932)

The color white in itself and when placed among other colors are beautiful.  Its symbolic connotations of purity, ethical, moral, and spiritual cleansing have a place in art and religion, but when the color of white becomes appropriated in a sociopolitical context or means, then the color becomes corrupted by the few with the likes of Mussolini; shaded, arrogant, narcissistic, socially brutal, and dangerous revisionary.

Epilogue

For the past is no stranger to the present or future.


Sources: Architectural Digest, BBC, Boston Globe, Dr. James Fox, Geology.Com, Getty Research Institute, Gold Traders UK, Metropolitan Museum of Art, Munsell Color, New York Times, NCPE- Barbara Klinkhammer, Paris Review, Wedgwood Museum, Wikipedia

All Rights Reserved, The Color of Three Stones: Gold, Lapi lazuli, and Marble © Richard Anthony Peña 2018

Blessed is the Night | Division Street


[Short Libretto-Ballad]

Blessed is the night. Go down these city streets, down Division Street, way down Division Street, where the wind sways the autumn trees, like an autumn song.  So blessed is the night.  Oh, the leaves rustle all around my feet, streetlamp lanterns, dancing shadows, nocturne patterns, with rod iron tones and brownstones, echoes-of-elevated-trains, and the sound-of-rain-in-the-night.

The wind brings the scent of the city, and life brings the sounds of the night.  Feel the change of the season in the night air, calling out, like an autumn song in the air. Oh, follow these footsteps down these city streets, down Division Street, way down Division Street, where the wind sways the autumn trees, like an autumn song, like-an-autumn-song.

Jukebox playing, the sounds of laughter, Puerto Ricans, tattooed queens, the polka spilling into the night, love songs and broken hearts. Settling the score, telling stories at the bar are not too far down these city streets. Latin Kings, Unknowns, and Playboys mark these streets and boulevards with studs and terkel rhymes, spray paint crimes, and the-sound-of-rain-in-the-night.

[Refrain]
Blessed is the night.  So blessed is the night. Go down these city streets, down Division Street, way down Division Street, where the wind sways the autumn trees, like an autumn song, like-an-autumn-song.  These-times-and-places, with painted faces, neon lights, streetlamp nights and Picasso faces.  Oh, these-Picasso-faces. Oh-so-blue, so-blue.

Oh, feel the change of the season in the night air, calling out, like an autumn song in the air.  Follow these footsteps down these city streets, go down Division Street, way down Division Street, where the wind sways the autumn trees, like an autumn song, like-an-autumn-song.  Streetlamp lanterns, dancing shadows, nocturne patterns, with rod iron tones and brownstones, echoes-of-elevated-trains, and the sound-of-rain-in-the-night.  Blessed-is-the-night.


All Rights Reserved, Blessed is the Night|Division Street, © Richard Anthony Peña 2018

Of Beauty, and of Death

 


Forgive me with kindness for speaking of something as morose such as of beauty and death in the same breath but both are breathing, iconic, mysterious, and often misunderstood. Beauty and of death are seldom the point of reflection in daily life given the emotional and spiritual weight they pay tribute to.  The world we know, filled with madness, sorrow, conflicts, chaos, diversions, and changes in life circumstances. The spirit of beauty and death exists like light and shadows on the wall or a chiaroscuro existence, rarely spoken of.

O’ beauty and of death, when do the drumbeats rest for those blessed?
When do the drumbeats rest for the transgressed?
When do the drumbeats rest for the obsessed?

O’ fortune’s spinning wheels of time, like full moons waning in the cadence of time.
I wonder of thine joyful life, like wine and the passing of time.
Taste the bread of O’ beauty, less dread of death put thou to the test in time.

Poem Of Beauty, and of Death © Richard Anthony Peña 2017

Our perceptions of beauty, and death, define our view of present and past tenses, we are often perplexed to which one appropriates the other, beauty or death?  Both beauty and death are like looking through a multi-colored kaleidoscope where the seer experiences the opposing mixtures of emotional patterns of nostalgia, joy, melancholy, fear, or ethereal feelings but all are optically misleading.  Lending to the misconception that in the end death appropriates all, including beauty.  Nothing could be further from the contrarian truth.

Of beauty and death, we recognize as absolute truths, marked by human language denoting words like, is or to be, like burning embers in the human imagination, creating constructs of what is beautiful or what it is to be or not to be.  Know truth, beauty is far from the conventional or popular perceptions where beauty is bemused with ideas what is pretty, attractive, eye-catching, or even artful.

For beauty is dangerous, beauty is dangerous to the corrupt and immoral world in that it attempts to cleanse and remove human transgressions from the world.  For our fruit is rotten, our fruit is rotten with corruption, diminutive thoughts, and fear of not.  For what is beauty or is beautiful, is a result of nature and moral goodness that removes or transforms human transgressions into mercy, grace, humility, and kindness, a heighten experience that transcends decadence, narcissism, arrogance, conceit, tyranny, and at its paramount, beauty becomes a collective organic moral human experience. Decadence, narcissism, arrogance, conceit, and tyranny, are aberrant enemies of beauty, often leading to objectification rather than to a greater and honorable end.

Now and then, works of art become objects of beauty, but such adoration is another form objectification unless works are masterworks of an artist, which elevates or ennobles the theater of the human condition in persuasion. Otherwise, such works become superfluous objects of anthropological nature, commoditized by the gallery-museum complex. Beauty must be dangerous to take hold in changing the world of the human experience; there is no substitute or deviation from originality. Beauty requires risks with a moral compass, even if it leads to being ignored, ostracized, or even of death, which is inevitable given life.

Of beauty, and of death, many fear the latter. Humankind throughout the ages has meditated on the mystery and subject of death with masterworks from antiquity to now, encompassing philosophy, theater, theology, painting, sculpture, literature, and newer mediums, which ultimately forms our perceptions of beauty, and of death.  When it comes to cultural, religious belief systems specifically precepts about human death under a religious context, those of the non-secular beliefs are comforted by their faith, while those of the secular beliefs find comfort with the minimalism of death, merely black and white, and nothing more.  Ultimately, death remains a mystery as the faith or belief we hold, regardless, if we are atheists, agnostics, or faithful believers, as all three ships have not yet left their safe harbor.

Of death, we often contrast with the ember of life, the physicality of the human body is a complex organic chemical, biological system, and clock, bonded together by atoms, and their electrons, neutrons, and protons, which are fragmentary elements created from the electromagnetic energy spectrum.  As humans, we cannot exist without the electromagnetic spectrum, somewhere between gamma rays and radio waves provides the building blocks of the right level of emitting energy or radiation that allows chemical elements to compound, solidify, and form organic life. The electromagnetic spectrum provides visible light in qualities that sustain life on earth.

Such is the razor edge that separates the difference between life and death, which is thin and fragile, like an invisible energy film between two spheres.  When the body dies and decomposes, the atoms from the body still stay around and sometimes break down into a radioactive decay slowly over time, it is estimated a proton half-life is roughly around 1.29×1034 years.  Simply put, the deceased body like any mass is made up of atoms, and the elements of the atom such as electrons, neutron, and protons, linger on in various states but remain on an atomic level over eternity.  When the body incinerates, the body turns into a form of Carbon (Symbol C) Atomic number 6.  Carbon is the fifteenth abundant element in the earth’s crust and the fourth abundant element by mass in the universe; in essence, the atom’s electrons, neutrons, and protons that make up the physicality of the human body after death remain in the atomic universe from which they came, ambient emitting atomic particles. Something Epicurus dreamt long ago.

From the winds of the distant past of antiquity, the whispers of Homeric souls blow across the windswept earth. Homeric poems contained one of the earliest usages of the word soul “psuche” in Hellenistic literature.  In the Homeric world, the soul always belongs to a human being and is one of the same.  The Homeric notion of the soul is something humans risk in life or battle; it is something only a human can have during life or lose after death, where the soul goes to the underworld; transmuted into shade or image of the deceased.

Achilles is always reflecting on risking the loss of his soul in the Iliad (9.322). By the fifth century, about the time of Socrates’ death, and towards the end of the sixth century, the semantics and meaning of soul changed, thought of, and spoken of as distinctive mark of livings things, capable of emotional states, faculty of reason, and bearer of virtues such as courage, beauty, and justice. The writings of Plato and Aristotle to some extent expanded the questions of the soul, and gradually over time, the Homeric idea of the soul lost hold with Hellenistic culture, but this allowed new ideas about the soul to transmute and form.

What came after was the word, “empsuchos” or “ensouled” which became the standard Hellenistic meaning for “alive” and that not just humans have a soul but all living things in the world have a soul.  The belief formed that the soul delineates which is alive from which is not, but moreover, what also defines the soul are virtues and actions of the living human being.

Our contemporaneous view of the soul, we are indebted to history with an obligatory note in hand to the writings of Homer, Thales, Socrates, Plato, Aristotle, Hippocrates, and Epicurus, who explored the nature what it is to be a human soul.  Such rich and fertile soil became the bed for the seeds of Western Abrahamic religious thought, our code, and moral inheritance.

Of beauty and death, do not fear. If you must have trepidation of the latter, observe the immoral conditions of your soul and the world, remove the transgressions such as decadence, narcissism, arrogance, conceit, ignorance, injustice, intolerance, the tyranny of men, and replace with the morality of beauty. Fear not death, fear beauty. Fear the absence of beauty from your soul and the world.  In the end, not death, but beauty appropriates all.

Of Beauty, and of Death

Antonio Lucio Vivaldi – Gloria

Antonio Lucio Vivaldi – The Four Seasons.

Antonio Lucio Vivaldi – Concerto for Two Trumpets in C Major

Claudio Giovanni Antonio Monteverdi – Vespers

Claudio Giovanni Antonio Monteverdi – L’Orfeo

Claudio Giovanni Antonio Monteverdi – Combattimento di Tancredi e Clorinda

Georg Friedrich Händel – Coronation Anthems

Georg Friedrich Händel – Water Music

Georg Friedrich Händel – Messiah

Johann Sebastian Bach – Brandenburg Concerto No. 2

Johann Sebastian Bach – Toccata and Fugue in D Minor

Johann Sebastian Bach – Orchestral Suite No.2 In B Minor

Franz Josef Haydn – Symphony No.59 in A Major “Fire”

Franz Josef Haydn – Trumpet Concerto

Franz Josef Haydn – Symphony No. 45 in F Minor “Farewell”

Wolfgang Amadeus Mozart – The Requiem in D Minor, K. 626

Wolfgang Amadeus Mozart – Piano Concerto No.20 D Minor K.466

Wolfgang Amadeus Mozart – Overture to “The Marriage of Figaro”

Ludwig Van Beethoven – Symphony No. 3 in E-flat Major, Op. 55

Ludwig Van Beethoven – Symphony No. 9 in D Minor, Op. 125

Ludwig Van Beethoven – Piano Sonata No. 3 Op 57

Franz Peter Schubert – Mass No. 6 in E-Flat Major D. 950 – III. Credo: Et in carnatus est

Franz Peter Schubert – Standchen

Franz Peter Schubert – Impromptus, Op. 90, D 899 – No. 4 in A Flat and Impromptu In G Flat

Johannes Brahms – Symphony 1 in C minor Op. 68

Johannes Brahms – Clarinet Quintet in B Minor Op. 115

Johannes Brahms – Hungarian Dances 1-21

Giuseppe Fortunino Francesco Verdi – Requiem

Giuseppe Fortunino Francesco Verdi – Rigoletto

Giuseppe Fortunino Francesco Verdi – La Traviata

Giacomo Antonio Domenico Michele Secondo Maria Puccini – La bohème

Giacomo Antonio Domenico Michele Secondo Maria Puccini – Tosca

Giacomo Antonio Domenico Michele Secondo Maria Puccini – Madame Butterfly

Gabriel Urbain Fauré – Requiem in D Minor, Op. 48

Gabriel Urbain Fauré – Pavane in F-sharp Minor, Op. 50

Gabriel Urbain Fauré – Sicilienne, for cello & piano, Op. 78

Joseph Maurice Ravel – Pavane Pour Une Infante Défunte

Joseph Maurice Ravel – Rapsodie Espagnole M.54 1-5

Joseph Maurice Ravel – Bolero

Frédéric François Chopin – Piano Sonata No. 2 in B Minor, Op. 35

Frédéric François Chopin – Nocturne Op.9 no.1

Frédéric François Chopin – Prelude in E Minor Op.28 No.4

Samuel Osborne Barber II – Adagio for Strings, String Quartet, Op. 11, and Agnus Dei

Samuel Osborne Barber II – Knoxville, Summer 1915

Samuel Osborne Barber II – Symphony No. 1

Joaquín Rodrigo Vidre, 1st Marquis of the Gardens of Aranjuez – Concierto de Aranjuez

Joaquín Rodrigo Vidre, 1st Marquis of the Gardens of Aranjuez – Fantasia para un gentilhombre

Joaquín Rodrigo Vidre, 1st Marquis of the Gardens of Aranjuez – Concierto Para Una Fiesta

Isaac Manuel Francisco Albéniz y Pascual – Asturias

Isaac Manuel Francisco Albéniz y Pascual – Evocación

Isaac Manuel Francisco Albéniz y Pascual – Pavana-Capricho Op. 1

Manual de Falla – Nights in Spanish Gardens

Manual de Falla – El Amor Brujo

Manual de Falla – Three Cornered Hat

Edvard Hagerup Grieg – Peer Gynt Suites

Edvard Hagerup Grieg – Solveig’s Song

Edvard Hagerup Grieg – Piano Concerto in A Minor, Op 16

Antonín Leopold Dvořák – Requiem

Antonín Leopold Dvořák – Symphony No. 9 “New World”

Antonín Leopold Dvořák – Song to the Moon

Sergei Sergeyevich Prokofiev – The Love of Three Oranges

Sergei Sergeyevich Prokofiev – Romero and Juliet

Sergei Sergeyevich Prokofiev – War and Peace, Op. 91, Symphonic Suite

Nikolai Andreyevich Rimsky-Korsakov – “The Rose and the Nightingale” for Flute & Piano

Nikolai Andreyevich Rimsky-Korsakov – Sheherazade Op. 35

Nikolai Andreyevich Rimsky-Korsakov – Capriccio Espagnol, Op.34 – 1

Sergei Vasilievich Rachmaninoff – Rhapsody on a Theme by Paganini, Op. 43

Sergei Vasilievich Rachmaninoff – Symphonic Dances op.45

Sergei Vasilievich Rachmaninoff – Piano Concerto No. 2 in C Minor, Op. 18

Alexander Porfiryevich Borodin – Steppes of Central Asia

Alexander Porfiryevich Borodin – Prince Igor

Alexander Porfiryevich Borodin – Symphony No. 2 in B Minor (revised N. Rimsky-Korsako)

Modest Petrovich Mussorgsky – Pictures at an Exhibition

Modest Petrovich Mussorgsky – Night on Bald Mountain

Modest Petrovich Mussorgsky – Khovanschina

Pyotr Ilyich Tchaikovsky – Piano Concerto No. 1 in B-Flat Minor Op. 23

Pyotr Ilyich Tchaikovsky – Symphony No. 6 in B Minor “Pathetique”

Pyotr Ilyich Tchaikovsky – Violin Concerto in D Major Op. 35 – Andante

Charles-Camille Saint-Saëns – Rondo Capriccioso, Op. 28

Charles-Camille Saint-Saëns – Carnival of the Animals

Charles-Camille Saint-Saëns – Samson and Delilah, Op. 47

Georges Bizet – Carmen

Georges Bizet – L’Arlesienne Suite

Georges Bizet – Nocturne in D major

Jacques Offenbach – The Tales of Hoffmann

Jacques Offenbach – La Vie Parisienne

Jacques Offenbach – Orphee – Orphée Aux Enfers

Achille-Claude Debussy – La Mer

Achille-Claude Debussy – Clair de lune

Achille-Claude Debussy – Rêverie

Franz Liszt – Transcendental Étude No. 4

Franz Liszt – Liebestraum No. 3

Franz Liszt – Hungarian Rhapsody no. 1-6

Johan Julius Christian Sibelius –  Finlandia, Op.26

Johan Julius Christian Sibelius –  Valse Triste, Op.44

Johan Julius Christian Sibelius – Karelia Suite Op. 11

Bedřich Smetana – Moldau

Bedřich Smetana – String Quartet N.1 in E Minor

Bedřich Smetana -Ma Vlast

Gustav Theodore Holst – The Planets

Gustav Theodore Holst – St. Pual Suite for Strings, Op 29

Gustav Theodore Holst – The Perfect Fool, Op.39

Gustav Mahler – Symphonies No.1 -10

Gustav Mahler – Rückert-Lieder

Gustav Mahler – Kindertotenlieder

Josef Anton Bruckner – Symphony No. 7 in E Major

Josef Anton Bruckner – Symphony No.5 in B Flat Major

Josef Anton Bruckner- Symphony No. 9 in D Minor

Sir Edward William Elgar, 1st Baronet – Enigma Variations, Op 36

Sir Edward William Elgar, 1st Baronet – Serenade For Strings In E Minor, Op 20

Sir Edward William Elgar, 1st Baronet – Salut d’Amour Op.12

Ralph Vaughn Williams – The Lark Ascending

Ralph Vaughn Williams – Fantasia on a Theme by Thomas Tallis

Ralph Vaughn Williams – Five Variants of ‘Dives and Lazarus’

Gioachino Antonio Rossini – Barber of Seville

Gioachino Antonio Rossini – La Donna del Lago

Gioachino Antonio Rossini – String Sonata in G Major

Louis-Hector Berlioz – Roman Carnival Overture, Op.9

Louis-Hector Berlioz – The Damnation of Faust

Louis-Hector Berlioz – Symphonie Fantastique

Dmitri Dmitriyevich Shostakovich – Symphony No. 4 in C Minor, Op. 43

Dmitri Dmitriyevich Shostakovich – Symphony No. 5 in D Minor, Op. 47

Dmitri Dmitriyevich Shostakovich – Jazz Suite No.2

Igor Fyodorovich Stravinsky – Rite of Spring

Igor Fyodorovich Stravinsky – The Firebird

Igor Fyodorovich Stravinsky – Orpheus

Aaron Copland – Quiet City

Aaron Copland – Symphony No.3

Aaron Copland – Concerto for Clarinet, Strings, Harp, & Piano

Leonard Bernstein – Symphony No. 1 “Jeremiah”

Leonard Bernstein – Symphony No. 2, “The Age of Anxiety”

Leonard Bernstein – Candide

Philip Morris Glass – Koyaanisqatsi

Philip Morris Glass – Metamorphosis

Philip Morris Glass – The Hours

Arvo Pärt – Da Pacem

Arvo Pärt – Tabula Rasa

Arvo Pärt – Silentium

“The past is never dead; it’s not even past”William Faulkner


Sources:  National Aeronautics and Space Administration, Futurism.com, Stanford Encyclopedia of Philosophy, IEP.Com-University of Tennessee, Wikipedia  

All Rights Reserved, Of Beauty, and of Death  © Richard Anthony Peña 2017

Poetry: Of Beauty, and of Death

 


O’ beauty and of death, when do the drumbeats rest for those blessed?
When do the drumbeats rest for the transgressed?
When do the drumbeats rest for the obsessed?

O’ beauty and of death, the sky is thy paper and the sea is thy ink.
Remember what beauty is, and the moon shall shed light on tomorrows’ dreams.
And the sun shall lure the flowers to the arch of the heavens.

O’ beauty what comes from the glow of roses in thy garden?
Red and rich like the blood of figs and thy sweet wine.
The sun and moon, thy constant watchmen, exalting sweetness.

O’ fortunes’ spinning wheels of time, like full moons waning in the cadence of time.
I wonder of thine joyful life, like wine, and the passing of time.
Taste the bread of O’ beauty, less dread of death put thou to the test in time.


All Rights Reserved, Of Beauty and Death © Richard Anthony Peña 2017

Panoramic Landscape Photography: Past and Present

 

Poetry: Deep Below the Rich Earth

 


Deep below the rich earth lays a reddish-brown bird. Every now and then, I hear the reddish-brown bird sing at night; songs of solitude and beauty resonate in the cadence of passing time.  I try to ignore the songs, but they take root in my memory like words to a contract, as unspoken bonds of servitude, like blood and bones, are to the rich brown earth.

Deep below the rich earth lays a reddish-brown bird.  Every now and then, I wonder how to capture its winged spirit.  Whose spirit abides witness to all, to every child, to every woman, and to every man inside us, as Seraphim of memory; time spent or mislaid.  The reddish-brown winged spirit was there with Perseus, Cadmus, and Bellerophon to foresee the courage to thrive, to persist, or all art would be but lost.  

Deep below the rich earth lays a reddish-brown bird.  Every now and then, I go out looking for the reddish-brown bird.  Sometimes, I visualize where the reddish-brown bird might hide, and try to capture its likeness in toil.  I wonder if the reddish-brown bird were free of the earth would the world be different in the collective memory it holds of you and me?  Oh, Perseus, Cadmus, and Bellerophon look towards the horizon, and there Athena waits below the line that separates the sun from the earth.

Deep below the rich earth lays a reddish-brown bird. Every now and then, I hear the reddish-brown bird sing at night; songs of solitude and beauty resonate in the cadence of passing time.  I try to ignore the songs, but they take root in my memory like words to a contract, as unspoken bonds of servitude, like blood and bones, are to the rich brown earth.  Oh, Athena, let the reddish-brown bird fly away. Fly away my muse, while Arachne weaves a web to catch the things we have, and the things we lose, to only find them once again, deep below the rich earth.


All Rights Reserved, Deep Below the Rich Earth © Richard Anthony Peña 2017

Michel Dahamani Gatlif: The Persistence of Memory, Light, and Transnationalism

 


The Romani people, also known as Gypsies historically became widely dispersed ethnic segment throughout the Middle East, North Africa, and Europe.  The Gypsies arrived in Europe from the Middle East in the fourteenth century, either separating from the Dom people or very closely having a similar history. Genetic findings in 2012, suggest they originated in northwest India and migrated as a group.  The ancestors of both the Romani and the Dom left North India sometime between sixth and eleventh centuries.

The Gypsy condition is in essence, the story of the human condition throughout all of human history as it specifically relates to the very nature of human migration across vast geographical regions.  In many ways, the Gypsy experience is an encapsulation that lends itself to the transnational thread of recent human migration of people in search of political and economic freedoms, enabling the workings of cross-cultural pollination that changes both the transnationalist and nationalist alike, where each opposing interest will adopt some aspects of each other’s culture.

The successful exchanges of cross-cultural ideas are the catalyst for social and economic change, are charged with subtlety but nuanced.  Such changes are always through cultural mechanisms of the socialization of the arts and language or freedoms of expression, that manifest both modern and legacy mediums, may it be digital assets or physical outcomes, and in the end are always successful in turning away from and against physical violence of any kind, e.g., Gandhi, Mandela, and King.

Without such cross-cultural pollination mechanisms and socialization, new ideas about human thought, democracy, cultural arts, science, and technology in all its forms would stagnate globally, leaving global populations siloed under the controlling oligarchies of politics, economics, and markets, as witnessed today.  In spite of the surge in populism with a vein of nationalism occurring in  2017, the observations of the cross-cultural pollination merits are neither new nor archaic, but always on razor’s edge of creativity and innovation of every era, in every century.

“India is the cradle of the human race, the birthplace of human speech, the mother of history, the grandmother of legend, and the great-grandmother of tradition”Mark Twain

Michel Dahamani Gatlif (b. 1948): French film director, screenwriter, composer, actor, and producer of motion pictures under the name of Tony Gatlif.  Born in Algiers, his mother a Gypsy and his father of Arab descent; his early childhood revolves around with his mother’s family of Andalusian Gypsies, and it is here in Algiers, Gatlif becomes exposed to his family’s rich Romani ethnic culture, which becomes a kernel in his memory that eventually leads to his creative efforts in filmmaking. Other than to film aficionados, his film works are virtually unknown to most of the North American public, and the narrative of the Gypsy world, which will be a theme in Gatlif’s most potent and compelling cinematic achievements.

By all measures, Tony Gatlif is an artist with a unique world vision; his early life consists of struggling against all the odds and obstacles against European social conventions and classism. Tony Gatlif found his way through the mean streets of Paris, to become a storyteller of wandering travelers, the unwanted, persecuted, and the musical cadence that bonds the Gypsies of Europe.

In 1960, Tony Gatlif at the age of twelve left his family to avoid an arranged marriage, and he decides to distance himself from the family, begins to work as a shoe-shiner on the streets. By the age of fourteen, he arrives in France and wanders between Marseilles and Paris, lives a life as a child of the streets with acts of delinquency, illiteracy, and thuggery.

“We were close to 500 children, we lived on the streets, free, we hated school, its fences, its benches, and we did not want to be locked up”.

On the grand boulevards of Paris, Gatlif spends most of his time in movie houses, finding the theater a warm and haven from the chaos of the streets. Gatlif, recalls in those days sleeping though show sessions of Jean-Luc Godard’s Breathless. During this same period, Gatlif ends up in a house of recovery; this will later serve as the basis of his first screenplay, La Rage in the fist.

One evening in 1966, an encounter that changed Gatlif’s life forever, he decides to go to see his idol, Michel Simon, in a play by René de Obaldia. At the end of the show, he works up the courage to slip into the dressing room of the immense actor, and there he faces the decisive moment of his life.

“I thought it was cinema, when the curtain opened on this big luminous box, with the real Michel Simon, it was a shock. When all the admirers left, Michel Simon who was removing make-up, turned and asked what I wanted, and I said, “I want to do cinema. Do you think it is possible? He stared at me for a long time, then with this huge voice; of course, it is possible!”

The encounter enables the actor to write a recommendation to the attention of his impresario on Gatlif’s behalf; this, in turn, allows Tony Gatlif joined a drama course in Saint-Germain-En-Laye.  Unable to read, Gatlif learned his first texts phonetically. In the following years, he cuts his teeth as a player in stage plays and begins to write his first screenplay with a plastic toy typewriter, La Rage in the fist.

In 1981, Gatlif, now the filmmaker begins themes of predilection, and he returns to Spain with the film Corre gitano Court métrage, the first film that recognizes the Gypsy condition. This film became the pantheon of his film trilogy of the Gypsy experience.

Les Princes (1983): About a Gypsy family, which revolves around the social, cultural, and economic conditions in the Paris suburb or outskirts, and the challenges they face as Gypsies.

Latcho Drom (1993): Journey through time, starting from Northern India and ending in Spain, a beautiful film hymn to Gypsy music and the transnational experience. Cannes Film Festival recognized Gatlif’s film.  “At the time, it was useless to use words to make a case for the Gypsies, so I used music as the key.”

Gadjo Dilo (1997): A young French man is wandering his way from Paris to Romania in search of the legendary singer of his father’s era, who goes by the name of Nora Luca. The young French man stumbles across with a community of Gypsies than becomes immersed into their community, and falls in love with Sabina, the daughter of the Gypsy who takes him in.  Romain Duris plays Stéphane, and Rona Hartner plays Sabina.

Other Notable Films:

Exils (2003): The film follows the trail of two young bohemians, a brooding Zano and a wildly passionate Naima who both decide to travel to Algeria to visit Zano’s once exiled parents. Romain Duris stars as Zano and Lubna Azabal as Naima. The film was also a homecoming for Gatlif as well after returning to Algeria 43 years later. The film features original music by Tony Gatlif and vocals by Rona Hartner. The film also won the Best Direction Award at the 2004 Cannes Film Festival.

Transylvania (2005): the story of Zingarina, a rebel Italian girl who travels to Transylvania with her best friend Marie, and a young interpreter named Luminita.  Zingarina is seeking to find a past lover, named Milan Agustin who finds himself expelled from France, where they had known each other in the past.  Zingarina finds him during a pagan festival (Herod’s Feast), where Milan ends their relationship. Zingarina endures her senseless travel through the boulevards and the villages, meets Tchangalo, a charming and traveling merchant of Turkish descent. Both director Tony Gatlif and composer Delphine Mantoulet won the “Georges Delerue Prize” at the Flanders International Film Festival for the film score, and Gatlif receives a nomination for the “Grand Prix” award in 2006.

Liberté (2008): The film takes place in a village in the occupied zone during the Second World War. Theodore, a veterinarian, and mayor of a town take in his home nine-year-old P’tit Claude whose parents have disappeared since the beginning of the war. The Gypsies who are nearby the village gather there to make the harvest. Mademoiselle Monday, the teacher made the acquaintance of the Gypsies, with the help of Theodore, arranged for Gypsy children to attend school. P’tit Claude became friends with Taloche, a thirty-year-old Bohemian gamin who walks around with his monkey on his shoulder. However, the identity checks imposed by the Vichy regime are multiplying and the Gypsies, a nomadic people, no longer have the right to move freely. P’tit Claude becomes increasingly fascinated by way of life of the Bohemians – a universe of freedom where children are kings; however, joy and carelessness are short-lived. The police and the Gestapo intensify their pressure and danger threatens at every moment.  As the Gypsies have always done for centuries, they will have to take to the road again.

Indignados / Indignez-vous (2012):  Gatlif abandons the world of Gypsies temporarily, to dedicate himself to Indignados, a documentary and freestyle film about the global protests in Europe, Middle East, and around the world including Chile, France, Greece, Israel, Japan, Mexico, UK, and North American occupy movements, all inspired by the book by Stéphane Hessel,”Indignez-Vous!” or “Time for Outrage!”   Stéphane Hessel (b.1917 – d.2013) was a diplomat, ambassador, writer, concentration camp survivor, French Resistance member.  Born in Germany, became a naturalized French citizen in 1939.  He became an observer of the editing of the Universal Declaration of Human Rights of 1948.  In the last years of his life, he was still active and focused on economic inequality and the injustices of European society.  The Spanish title of Indignados is from the movement of the “Indignados” in Spain.

Geronimo (2014): A film about the universe of Gypsies which takes place within the urban Paris landscape or backdrop.  The film, which is rhythmic in dance, deals with themes related to the world of the street, in which young people seek freedom. Gatlif draws inspiration from his personal story. The story setting takes place in the South of France. Enters Geronimo, a young social educator, she attempts to ease tensions between the youngsters of the St Pierre neighborhood, but tempers flare up with the heat of the summer when Nil Terzi, a teenage girl of Turkish origin, rejects an arranged marriage, flees to the arms of her Gypsy lover, Lucky Molina. Their plan to run away results in hostilities between the two clans and manifests into jousting and the musical battles.  Geronimo is left with the struggle to manage the conflicts and ensuing chaos around her.  French actress, Céline Sallette plays the role of Geronimo.

Film Chronology:
2017 Djam
2014 Geronimo
2012 Indignados
2008 Liberté
2007 Vertiges – Du flamenco à la transe
2005 Transylvania
2004 Visions of Europe
2003 Exils
2001 Swing
2000 Vengo
1998 Je suis né d’une cigogne
1997 Gadjo Dilo
1995 Lucumi, le rumbero de Cuba
1995 Mondo
1993 Latcho Drom
1990 Gaspard et Robinson
1989 Pleure pas my love
1985 Rue du départ
1982 Canta Gitano Court métrage
1982 Les Princes
1981 Corre Gitano Court métrage
1978 La Terre au ventre


Sources: Festival De Cannes, Mubi.com, AlloCine, IMDb, YouTube.com, Facebook.com,Tonygatlif.Free.Fr, and Wikipedia

All Rights Reserved © Richard Anthony Peña 2017

Antonio Gil Y’Barbo – Pioneer, Deal Maker, and Father of Nacogdoches

 


Antonio Gil Y’Barbo, known as the Father of Nacogdoches, Texas, was born in 1729 in Los Adaes Presidio, New Spain.  His parents, Spanish colonists, Matheo Antonio Y’Barbo (b. 1698) and Juana Luzgarda Hernandez (b.1705) both born in Spain, were early arrivals to the Los Adaes Presidio, located on the northeastern frontier of New Spain from 1729 to 1770.  Serving in the Spanish military, Brevet Lieutenant Matheo Antonio Y’Barbo was deployed by the Spanish Royal Crown to Los Adaes to defend New Spain against French expansion.

The Los Adaes Presidio also included a mission, Nuestra Señora del Pilar de Los Adaes.  Now a historic national monument, Nuestra Señora del Pilar de Los Adaes is located in present-day Natchitoches Parish, Louisiana.  The marriage registry of the mission church of San Antonio de Valero (the Alamo) documents the date of marriage for Matheo Antonio Y’Barbo and Juana Luzgarda Hernandez as April 28, 1723.

Following his father’s example, Antonio Gil Y’Barbo served in the Spanish military, yet also became involved in cattle ranching, where he established a cattle ranch near Lobanillo Creek, located in present-day Sabine County, Texas.  Antonio Gil Y’Barbo married Maria Davila Padilla, his first wife, having four children.  Antonio Gil Y’Barbo stated in his will dated May 19, 1800:

“I had two male children and two female children by my first wife, namely Mariano, Marcos, Maria Antonia, and Maria Josefa, of the following, are now dead; the first two, and the last, who have a legitimate issue as she is still living.”

The Los Adaes Presidio, established initially to counter French intrusions into Spanish territory.  At the close of the French and Indian War, 1767, the Los Adaes outpost became nonessential.  Louisiana then ceded to Spain in terms included in the Peace of Paris in 1763 which terminated the Seven Year’ War.  In the same year of the 1763 Peace of Paris agreement, the Marques de Rubi then appointed to oversee the inspection of the northeastern frontier of New Spain and executed the Royal Order of 1772 by the King of Spain, the closing of the presidios and missions of northeastern frontier.

With little time to prepare, the military garrison, their families, and other colonists, numbering around 500 at the time, ordered by the Spanish Royal Crown to abandon the post, and relocate to San Antonio de Bexar.  Antonio Gil Y’Barbo, emerged as the de facto leader of the colonists even before the departure from Los Adaes, as he had the confidence of Baron Juan Maria Vicencio de Ripperda, Governor of Tejas, who entrusted him with the administration of government funds for purchasing supplies for the Presidio of Los Adaes.

In the summer of 1773, the departure to San Antonio de Bexar posed extreme hardships for the colonists and their families.  Lieutenant Jose Gonzales, the commander, leading the expedition back to San Antonio de Bexar, died on July 30, 1773, from such hardships of harsh three-month walk imposed upon the colonists. The colonists at this point appointed Antonio Gil Y’Barbo to lead them for the remainder of the withdrawal back to San Antonio.  By summer’s end, after harsh conditions, exposure to famine, and fatigue, Antonio Gil Y’Barbo successfully led 167 disheartened, tired, and health broken colonists into San Antonio de Bexar.

The arrival of the Los Adaes colonists was just the beginning of their discontent with their new location, and Antonio Gil Y’Barbo made repeated efforts on behalf of the colonists petitioning authorities at Bexar to allow their return to the northeastern frontier.   Baron Juan Maria Vicencio de Ripperda, Governor of Tejas, suggested to Antonio Gil Y’Barbo to carry their petition to Viceroy of New Spain, Antonio Bucareli, for approval.  As a result, the Viceroy approved the colonists to move to a new site on the Trinity.

The Trinity site appeared to be a reasonable location for a new outpost.  Trinity provided a way station between Bexar and the then-Spanish presidio at Natchitoches, and would provide a base for relations with friendly Bidai Indians in the area, also providing the disenchanted colonists a haven, as it would serve as a checkpoint against illicit trade. Potentially, this was also a strategy to prevent the British freebooting Spanish ships from the upper coastal bend of Texas.  A factor that loomed, however, was Spain’s alignment with the American Revolutionaries’ cause against Britain, which had developed.

During this period of the American Revolutionary War, Spaniards like Y’Barbo raised cattle in East Texas for feeding the army of Bernardo de Galvez (b.1746).  General Galvez was instrumental in support of the American Revolutionaries and provided food provisions, and other necessary supplies delivered up the Mississippi River to feed and arm the American Revolutionaries in the East.

Without the support of the Spanish as a silent partner in American Revolutionary War by providing much needed provisions, bankrolling trade, and the Spanish military and navy numerous engagements to fight the British on behalf of the American Revolutionaries, the outcome of the American Revolutionary War would have been bleak for American Revolutionaries in Yorktown and Southern region.  The American Revolutionary War battles fought under General Bernardo de Galvez;  Capture of Fort Bute, Battle of Baton Rouge, Battle of Fort Charlotte, and Battle of Pensacola. Galvez’s Louisiana army was made up of Native Americans, Free Slaves, Red Bones, and Spaniards.

In the August of 1774, Antonio Gil Y’Barbo and the colonists left San Antonio, arriving in their new settlement location six months later in February 1775.   By June of 1775, fifty wooden houses with corrals, fields, roads, and improved river crossings came to fruition at the Bucarelli settlement.  This new settlement, according to the Spanish census, at the time,  recorded 347 inhabitants.  All went reasonably well until 1779 when a series of Comanche Indian raids and a devastating Trinity River flood significantly diminished the opportunity to occupy the settlement any longer.

Sometime in late Spring of 1779, Antonio Gil Y’Barbo again seized the initiative, reasserted his leadership abilities, and set out for East Texas without official sanctions.  Captain Antonio Gil Y’Barbo led 300 to 350 weary former Adaesanos into the little valley between two flowing streams in East Texas, which later became known as Nuestra Señora del Pilar de Nacogdoches.  It was here the former Adaesanos found a sense of place among the pines of East Texas.  Antonio Gil Y’Barbo’s persistence, action, and diplomacy succeeded in mitigating the Royal Order of 1772.

With the establishment of Nacogdoches, a new page was created in the history of Spanish settlements in Texas, as Nacogdoches became the center of trade rather than Los Adaes.  The request for trading with the Indians now granted, and Y’Barbo quickly became among the Indians of Northeast Texas the most influential Spaniard of the day. The officials in San Antonio de Bexar and Mexico City recognized his unique talents in holding the colonist together during the difficult transition, established successful relationships with the Indians of the region, and keeping useful diplomatic correspondence with the French, and the Americans to the East, which led to his promotion to Lieutenant Governor of Nacogdoches.

Antonio Gil Y’Barbo quickly went to work in the region, establishing a commodity-based economic system with the Indians, establishing a blueprint of a civil design of Nacogdoches with blocks and streets following traditional Spanish pattern of a central plaza surrounded by religious, government, military, and other centers.  Nacogdoches became a viable trading center point on the El Camino Real, a vibrant town, and culture, on special occasions, residents,walked around the square speaking an assortment of languages, and wearing clothing designating a variety of ethnic backgrounds.”  By the beginnings of the 1800s, Nacogdoches became the second largest Texas settlement.

Antonio Gil Y’Barbo governed Nacogdoches for ten years after Antonio Gil Y’Barbo tendered his resignation as civil Governor in 1790.   In 1791, formally accused of smuggling contraband, and trading with the Indians for horses stolen from the Spanish, Antonio Gil Y’Barbo was found acquitted and cleared of all charges brought against him.  In his eightieth year, about 1809, Antonio Gil Y’Barbo died at Rancho La Lucana and buried in the Old Spanish Cemetery in Nacogdoches.  The distinguished historian of Spanish Texas, Carlos E. Castaneda, describes Antonio Gil Y’Barbo as one of those remarkable leaders of men which pioneer communities sometimes engender.”

Credits and Primary Sources:

  • Carolyn Reeves Ericson and Linda Ericson Devereaux, Antonio Gil Y’Barbo, The Father of Nacogdoches, 1995, pages i-xv
  • Linda Ericson Devereaux, Y’Barbo and Mora Families, (Nacogdoches, Ericson Books, 1994)
  • Frederick C. Chabot, With the Makers of San Antonio, (San Antonio; Privately Published, 1937)
  • Carlos E. Castaneda, Our Catholic Heritage in Texas – 1519 to 1936, (New York, Arno Press, 1976, reprint edition, seven volumes, Vos. IV and V).
  • Robert Bruce Blake, B. Blake Research Collection, Texas History Center
  • W. Steen Library, Stephen F. Austin State University, Nacogdoches, 85 volumes
  • Shirley Seifert, By the King’s Command, (Philadelphia, J.B. Lippincott Company).
  • Bexar Archives, Dolph Briscoe Center for American History, the University of Texas at Austin
  • Barbara A. Mitchell, America’s Spanish Savior: Bernardo de Gálvez, HistoryNet

All Rights Reserved, Antonio Gil Y’Barbo – Pioneer, Deal Maker, and Father of Nacogdoches © Richard Anthony Peña 2017

Genetic Genealogy: Children of the Sun

 


In the night sky, the stars form patterns of mythical shapes, and twisting outlines, like a jeweled crown of thorns, with points of Jupiter, Mars, Saturn, Sirius, and Venus.  As the stars and constellations move across the darkness of the night sky, the starry crown twists, and turns, and forms a ladder leading us into the depths of the heavens, from where all heavenly resources of earthly elements originated from.  All that makes life possible such as carbon, hydrogen, oxygen, nitrogen, and phosphorus, along with all the earthly elements connects us, in turn, unifies all of life with the heavens, the constellations, and even to our sun.  As these chemical elements are the bonds between earthly life, and to the rest of the universe, in which the physicality of deoxyribose nucleic acid could not be possible without its rich heritage to the rest of the universe, as it is this heritage, which is the physical Genesis, the fabric of human, animal, and plant life.

Children of the Sun

We are the children of the light.
The crimson sun guides us.
Remember us for we lived for beauty.
Remember us for we lived for love.
Remember us for we lived for originality.
As the light of time leaves us behind,
Remember us.

We are the children of the darkness.
The moonlight so blue guides us.
Remember us for we lived for discord.
Remember us for we lived for hate.
Remember us for we lived for revolution.
As the darkness of time leaves us behind,
Remember us. 

Children of the Sun © Richard Anthony Peña 

The Code of Life

The code of life begins with cells that are the basic building blocks of all living things. The human body in its formality, composed of trillions of cells, and provides structure for the body, take in nutrients, convert those nutrients into energy, and carry out specialized functions.  It is here, in the cells that contain the body’s hereditary material, called DNA, or deoxyribonucleic acid, which is the hereditary chemical material in humans, and in almost all living organisms.  Most of all DNA is located in the cell nucleus (nuclear DNA), but also there is a small amount of DNA can also be found in the mitochondria (mitochondrial DNA or mtDNA).

The Cellular Structure

   Cytoplasm:  Within cells, the cytoplasm is made up of a jelly-like fluid (called the cytosol) and other structures that surround the nucleus.

  Cytoskeleton:  The cytoskeleton is a network of long fibers that make up the cell’s structural framework. The cytoskeleton has several critical functions, including determining cell shape, participating in cell division, and allowing cells to move. It also provides a track-like system that directs the movement of organelles and other substances within cells.

∃   Endoplasmic Reticulum (ER):  This organelle helps process molecules created by the cell. The endoplasmic reticulum also transports these molecules to their specific destinations either inside or outside the cell.

∃   Golgi Apparatus:  The Golgi apparatus packages molecules processed by the endoplasmic reticulum to be transported out of the cell.

   Lysosomes and Peroxisomes:  These organelles are the recycling center of the cell. They digest foreign bacteria that invade the cell, rid the cell of toxic substances, and recycle worn-out cell components.

∃   Mitochondria:  Mitochondria are complex organelles that convert energy from food into a form that the cell can use. They have their genetic material, separate from the DNA in the nucleus, and can make copies of themselves.

∃   Nucleus:  The nucleus serves as the cell’s command center, sending directions to the cell to grow, mature, divide, or die. It also houses DNA (deoxyribonucleic acid), the cell’s hereditary material. The nucleus is surrounded by a membrane called the nuclear envelope, which protects the DNA, and separates the nucleus from the rest of the cell.

∃   Plasma Membrane:  The plasma membrane is the outer lining of the cell. It separates the cell from its environment and allows materials to enter and leave the cell.

∃   Ribosomes:  Ribosomes are organelles that process the cell’s genetic instructions to create proteins. These organelles can float freely in the cytoplasm or be connected to the endoplasmic reticulum (see above).

Sources:
i.) U.S. National Library of Medicine
ii.) The Genetic Science Learning Center at the University of Utah offers an interactive introduction to cells and their many functions.
iii.) Arizona State University’s “Ask a Biologist” provides a description and illustration of each of the cell’s organelles.
iv.) Queen Mary University of London allows you to explore a 3-D cell and its parts.
v.) The Biology Project: University of Arizona

DNA Structure:

Deoxyribose nucleic Acid consists of two parts; Deoxyribose is a ribose sugar without oxygen element, and Nucleic Acid makes-up the rest of the molecule. The DNA backbone is made up of a sugar (deoxyribose) phosphate, and the bases attach onto the sugars and stick out almost at right angles into the center of the helix. The bases contain C, H, O, and N.

Double Helix Structure:

  • Right-handed Double Helix
  • Four bases which specifically base pair in a Watson and Crick formulation.
  • AT (Adenine – Thymine always pair together)
  • G-C (Guanine – Cytosine always pair together)
  • There are two Purine bases (single rings) – A and G
  • There are two Pyrimidines (double rings) – T and C
  • The helix is the same width all the way down (about 2 nanometers) due to Purines and Pyrimidines bases paring.
  • DNA sequence is listing the bases along either one of the two sides. For example, one side might read as T G T T C G T C, etc.
  • There are minor and major grooves caused again by the different sized bases. The major grooves are allowing enzymes to probe the bases, and to bind.

                         DNA Double Helix

A segment of DNA contains the code used to synthesize protein, chromosomes contain hundreds to thousands of genes. Every human cell has 23 pairs of chromosomes, the total of 46 chromosomes.  Human traits are gene-determined characteristic, and often determined by more than one gene. There are traits caused by abnormal genes, which are inherited or are the result of new mutations occurring during one’s lifetime.  Proteins are the most important class of biomolecules in the body. Proteins are the building blocks of muscles, connective tissues, skin, and other biological formations. Proteins also are needed to make enzymes.  Enzymes are complex proteins, which carry out nearly all chemical processes, and reactions within the body.  Your body produces tens of thousands of different kinds of enzymes, in which these types and amounts of proteins govern your entire body.  The syntheses of proteins are controlled by genes, which are contained in chromosomes.  An important characteristic of DNA is that it can replicate, or simply make copies of itself. Each strand of DNA in the double helix serves as a pattern for duplicating the sequence of bases. This is important when cells divide because each new cell needs to have an exact copy of the DNA present in the old cell.

Genetic Genealogy: Today, we are fortunate that the science of Genetic DNA now has evolved into consumer-based testing, which now is more accessible, and has opened up a new and growing field of genetic genealogy.  Genetic genealogy is the marriage of both traditional genealogy and genetic DNA findings.  One might say, “who cares” or “my family so messed up, I don’t want to know” but in time, you will.  In some point in your life, you will have deeper questions, why you are the way you are or why I was born with these traits?  The sum of the DNA code and mutations that make you unique are the historical biological markers and coded keys to your bloodline.  Your bloodline and pedigree are important, they are the road-map back into genealogical time, where your bloodline migrated from, and not only a genealogical map of your forebears but your relationship to the world you live in (who you are), and legacy to human history.

Traditional Genealogy:  The word Genealogy derived from the Greek word gena and logos (generation knowledge).  Genealogy is the study of generations of families through time or what is called “genealogical time” with such methods as genealogical charts or family trees based on supporting documentation of family surnames, vital records, church records, and U.S. Census Records (1800-1940).  Traditional genealogy is simply providing proof of your pedigree with legitimate and accepted records such as birth records, death certificates, church records, books, newspaper citations or any accepted forms of records. Nothing more required than good and valid research. Genealogy alone is the most difficult puzzle to solve in that there are many sand traps along the way such as surnames can change over time, confusion  of birth names, out of wedlock births, adoptions, erroneous vital records, lost or destroyed records,  Y-DNA line termination, collapse family tree, family lore verse facts, are indeed the most common challenges.

DNA Genealogy:  At the center of this discipline, there are three common types of tests when it comes to DNA Genealogy, Y-DNA, mtDNA, and Autosomal DNA.  Each test has a specific function, for example, Y-DNA tests are for your paternal line, which is confirmation of your Father’s direct line (Father, Grandfather, Great Grandfather, GG Grandfather, and so on to your Adam).   mtDNA tests are for your maternal line, which is confirmation of your Mother’s direct line (Mother, Grandmother, Great Grandmother, GG Grandmother, and so on to your Eve).  The Autosomal  DNA test confirms your distant DNA cousins and can be resulted regardless of one’s birth sex.  With DNA Genealogy, there are broader and finer degrees of relationships, in that there are relationships that are only associated with broader Haplogroup family, but not with a finer degree of relationships in your family tree, and vice versa.

One receives twenty-three pairs of chromosomes from one’s Father and twenty-three pairs of chromosomes from one’s Mother or forty-six chromosomes from both parents. The twenty-two of the twenty-three pairs of the chromosomes represents the Autosomal  DNA.  The twenty-third pairs are the sex chromosome that delineates between females and males.  Females have two copies of the X-chromosomes, while males have one X and one Y chromosome.  With this said, keep in mind that you will only inherit 50% of your parent’s Autosomal DNA, and your parents only inherited 50% from their parents, and so on.  So the farther you go back in genealogical time, the percentages of inherited Autosomal DNA decreases from your ancestors; however, your direct Y-DNA and mtDNA will remain constant over genealogical time.  DNA testing alone is not absolute, as like traditional genealogy, it can be tricky, as there is variability between labs, specimen quality, source references, algorithms, therefore, good, and valid paper research is necessary to go together with the DNA digital data.

DNA Testing Services

(Source: ISOGG)

Types of Genetic DNA Tests

The Family Tree:  Autosomal DNA (maternal and paternal DNA relatives, deep ethnicity)  Twenty-two of the twenty-three pairs of the chromosome represent the Autosomal  DNA.  The twenty-third pair is the sex chromosome that delineates between females and males.  Females have two copies of the X-chromosomes, while males have one X and one Y chromosome.  Again, an important reminder; you inherit 50% of your parent’s Autosomal DNA, and your parents only inherited 50% of their parents, and so on.  So the farther you go back in genealogical time, the percentages of inherited Autosomal DNA decreases from your ancestors.  You are a result of the probability of all who came before you.

Father’s Direct Line:  Y-DNA (12 markers, 25 markers, 37 markers, 67, markers, 111 markers)  The sample STR Results without SNP tests below illustrates how to interpret your DNA results on Y-DNA 12 Marker Test.  The values listed in the fig. 1 Y-DNA 12 Marker Result represent each sequence on location on the Y-DNA chromosome.  Let’s take the location of DYS#426 based on the sequence below:

TGTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGAC…

As you can see from the DNA sequence above, there are 12 sets of GTT, and this value counted under DYS# 426 in fig.1.  The same concept would apply to the 25, 37, 67, and 111 Y-DNA Markers Tests as well.  As a rule of thumb, the higher the Y-DNA Marker test, the more confidence is placed on the matches as a direct relationship to your paternal line.

Fig. 1 Y-DNA 12 Marker Result:

DYS#

393

390

19**

391

385a

385b

426

388

439

389-1

392

389-2

Alleles

12

24

14

11

11

14

12

12

13

13

13

29

**Also known as DYS#394

Mother’s Direct Line:  mtDNA (HVR1 and HVR2, Full Sequence)  The standard for mtDNA genome based on the Cambridge Reference Sequence (CRS). All the differences between your mtDNA and the CRS returned as the results. These results are predictive and used to estimate one’s mtDNA Haplogroup.  Roughly, estimates the amount of time to which individuals share a most recent common ancestor (MRCA).  The alphabet letter designation represents the DNA code of the Adenine, Thymine, Guanine, and Cytosine.

HVR 1 DIFFERENCES FROM rCRS

16111T

16223T

16290T

16319A

16335G

16526

 

HVR 2 DIFFERENCES FROM rCRS

64T

73G

146C

153G

235G

263G

309.1C

315.1C

522-

523-

SNP Testing:  SNP (Single-nucleotide polymorphism) tests can reveal the changes in the single nucleotide within the DNA sequence.  Over time, the DNA makes copies of itself, and this process can result in errors known as mutation or polymorphisms.  SNP tests can determine a person’s exact haplogroup, and subclades if available or in other words, one’s deep ancestry.

Haplogroups:   From the Greek word haploûs, one fold, single, simple. The definition of a haplogroup is a genetic population group of people who share a common ancestor either on the patrilineal or matrilineal line. Haplogroups are assigned letters of the alphabet, and refinements consist of additional number and letter combinations to specific population sets.   Please keep in mind, that Haplogroups have very broad trees and branches of human migration over tens of thousands of years.  DNA and Y-SNP (single nucleotide polymorphism) testing can define the specific haplogroup that you inherited from your mother and father.  The International Society of Genetic Genealogy (ISOGG) maintains current ongoing research of both Y-DNA and mtDNA haplogroups and subclades.

In some cases, like Family Tree DNA’s Big Y Test result can pinpoint one’s paternal haplogroup to a specific subclade, predictive region, and age.  My example, R-Y23968 is a haplogroup that is estimated to be 4,200 (YBP) years before present. This specific haplogroup R-Y23968 which is a subclade of R-DF27 originated in Europe, since an ancient specimen from Quedlinburg, Germany from about 4246-4156 years ago tested positive for R-DF27.  The consensus among genetic genealogists, the male population set specific to the Americas with Haplogroup R-D27 is generally thought of as an ancient Iberian group or subclade, which left Spain after 1492. R-DF27 is considered a common Y-chromosome clade of paternal lineages from Western Europe, and as to a specific subclade representative of men with Spanish genetic heritage could have future possibilities as more data becomes acquired over time.

Y-DNA Human Migration (Haplogroups) – Source: FTDNA 
Thousands of Years Ago

A 60 G 20 O3 35
B 50 H 30 P 35
CT 50 I 25 Q 20
D 50 J 25 Q1a3a 10
E 50 K 40 R 30
E1b1a 20 L 30 R1a 10
E1b1b 20 M 10 R1b 25
C 50 N 10 S 10
F 45 O 35 T 10

mtDNA Human Migration (Haplogroups)  – Source: FTDNA 
Thousands of Years Ago

A 30 J 40 R 50
B 50 K 25 R0 30
C 20 L0 >100 T 20
D 25 L1 >100 U 50
F 50 L2 80 V 15
H 30 L3 70 W 20
HV 30 M 60 X 30
I 15 N 50 Z 30

 

DNA Tools: ISOGG Autosomal DNA_tools

#DNA*Genealogy


Credits and Sources:  Arizona State University, Blaine Bettinger (www.thegeneticgenealogist.com), Family Tree DNA (FTDNA), 23andme, Genetic Science Learning Center at the University of Utah, Queen Mary University of London , The International Society of Genetic Genealogy (ISOGG), University of Arizona, U.S. National Library of Medicine, National Institute of Health, Wikipedia

Rights Reserved  Genetic Genealogy – Children of the Sun © Richard Anthony Peña 2017

Elegy: Children of the Sun

 


In the night sky, the stars form patterns of mythical shapes, and twisting outlines, like a jeweled crown of thorns, with points of Jupiter, Mars, Saturn, Sirius, and Venus, that shine beyond the horn of the imagination.  As the stars and constellations move across the darkness of the night, the starry crown twists and turns, forming a ladder leading us into the depths of the heavens, far beyond our time. Oh, Children of the Sun, remember us.

We are the children of the light.
The crimson Sun guides us.
Remember us for we lived for beauty.
Remember us for we lived for love.
Remember us for we lived for originality.
As the light of time leaves us behind.
Remember us.

We are the children of the darkness.
The moonlight so blue guides us.
Remember us for we lived for discord.
Remember us for we lived for hate.
Remember us for we lived for revolution.
As the darkness of time leaves us behind.
Remember us. 

Alas, there may be fire, Alas there may be ice, codes of heaven and hell.
Oh, fiery Venus, cold distant warrior of Mars, and hungry Saturn will.
Everything falls in between.
We are the children of beauty and discord.
We are the children of love and hate.
We are the children of originality and rebellion.
Remember us.
We are the Children of the Sun.


All Rights Reserved, Children of the Sun © Richard Anthony Peña 2017