Genetic Genealogy: Children of the Sun


In the night sky, the stars form patterns of mythical shapes, and twisting outlines, like a jeweled crown of thorns, with points of Jupiter, Mars, Saturn, Sirius, and Venus.  As the stars, and constellations move across the darkness of the night sky, the starry crown twists and turns, and forms a ladder leading us into the depths of the heavens, from where all heavenly resources of earthly elements originated from.  All that makes life possible such as carbon, hydrogen, oxygen, nitrogen, and phosphorus, along with all the earthly elements connects us, in turn, unifies all of life with the heavens, the constellations, and even to our own sun.  As these chemical elements are the bonds between earthly life, and to the rest of the universe, in which the physicality of deoxyribosenucleic acid could not be possible without its rich heritage to the rest of the universe, as it is this heritage, which is the physical genesis, the fabric of human, animal, and plant life.

Children of the Sun

We are the children of the light.
The crimson sun guides us.
Remember us for we lived for beauty.
Remember us for we lived for love.
Remember us for we lived for originality.
As the light of time leaves us behind,
Remember us.

We are the children of the darkness.
The moonlight so blue guides us.
Remember us for we lived for discord.
Remember us for we lived for hate.
Remember us for we lived for revolution.
As the darkness of time leaves us behind,
Remember us. 

Children of the Sun © Richard Anthony Peña 

The Code of Life

The code of life begins with cells that are the basic building blocks of all living things. The human body in its formality, is composed of trillions of cells, and provides structure for the body, takes in nutrients, convert those nutrients into energy, and carry out specialized functions.  It is here, in the cells that contain the body’s hereditary material, called DNA, or deoxyribonucleic acid, which is the hereditary chemical material in humans, and almost all living organisms.  Most of all DNA is located in the cell nucleus (nuclear DNA), but also there is small amount of DNA can also be found in the mitochondria (mitochondrial DNA or mtDNA).

The Cellular Structure

   Cytoplasm:  Within cells, the cytoplasm is made up of a jelly-like fluid (called the cytosol) and other structures that surround the nucleus.

  Cytoskeleton:  The cytoskeleton is a network of long fibers that make up the cell’s structural framework. The cytoskeleton has several critical functions, including determining cell shape, participating in cell division, and allowing cells to move. It also provides a track-like system that directs the movement of organelles and other substances within cells.

∃   Endoplasmic Reticulum (ER):  This organelle helps process molecules created by the cell. The endoplasmic reticulum also transports these molecules to their specific destinations either inside or outside the cell.

∃   Golgi Apparatus:  The Golgi apparatus packages molecules processed by the endoplasmic reticulum to be transported out of the cell.

   Lysosomes and Peroxisomes:  These organelles are the recycling center of the cell. They digest foreign bacteria that invade the cell, rid the cell of toxic substances, and recycle worn-out cell components.

∃   Mitochondria:  Mitochondria are complex organelles that convert energy from food into a form that the cell can use. They have their own genetic material, separate from the DNA in the nucleus, and can make copies of themselves.

∃   Nucleus:  The nucleus serves as the cell’s command center, sending directions to the cell to grow, mature, divide, or die. It also houses DNA (deoxyribonucleic acid), the cell’s hereditary material. The nucleus is surrounded by a membrane called the nuclear envelope, which protects the DNA, and separates the nucleus from the rest of the cell.

∃   Plasma Membrane:  Thee plasma membrane is the outer lining of the cell. It separates the cell from its environment and allows materials to enter and leave the cell.

∃   Ribosomes:  Ribosomes are organelles that process the cell’s genetic instructions to create proteins. These organelles can float freely in the cytoplasm or be connected to the endoplasmic reticulum (see above).

Sources:
i.) U.S. National Library of Medicine
ii.) The Genetic Science Learning Center at the University of Utah offers an interactive introduction to cells and their many functions.
iii.) Arizona State University’s “Ask a Biologist” provides a description and illustration of each of the cell’s organelles.
iv.) Queen Mary University of London allows you to explore a 3-D cell and its parts.
v.) The Biology Project: University of Arizona

DNA Structure:

Doxyribosenucleic Acid consists of two parts; Deoxyribose is a ribose sugar without oxygen element, and Nucleic Acid makes-up the rest of the molecule. The DNA backbone is made-up of a sugar (deoxyribose) phosphate, and the bases attach onto the sugars, and stick out almost at right angles into the center of the helix. The bases contain C, H, O, and N.

Double Helix Structure:

  • Right-handed Double Helix
  • Four bases which specifically base pair in a Watson and Crick formulation.
    AT (Adenine – Thymine always pair together)
    G-C (Guanine – Cytosine always pair together)
  • There are two Purine bases (single rings) – A and G
  • There are two Pyrimidines (double rings) – T and C
  • The helix is the same width all the way down (about 2 nanometers) due to Purines and Pyrimidines bases paring.
  • DNA sequence is listing the bases along either one of the two sides. For example, one side might read as T G T T C G T C, etc.
  • There are minor and major grooves, caused again by the different sized bases. The major grooves are allowing enzymes to probe the bases, and to bind.

                         DNA Double Helix

A segment of DNA contains the code used to synthesize protein, chromosomes contains hundreds to thousands of genes. Every human cell has 23 pairs of chromosomes, total of 46 chromosomes.  Human traits are gene-determined characteristic, and often determined by more than one gene. There are traits caused by abnormal genes, which are inherited or are the result of a new mutations occurring during one’s lifetime.  Proteins are the most important class of bio-molecules in the body. Proteins are the building blocks for muscles, connective tissues, skin, and other biological formations. Proteins also are needed to make enzymes.  Enzymes are complex proteins, which carry out nearly all chemical processes, and reactions within the body.  Your body produces tens of thousands of different kinds of enzymes, in which these types and amounts of proteins govern your entire body.  The syntheses of proteins are controlled by genes, which are contained in chromosomes.  An important characteristic of DNA is that it can replicate, or simply make copies of itself. Each strand of DNA in the double helix serves as a pattern for duplicating the sequence of bases. This is important when cells divide because each new cell needs to have an exact copy of the DNA present in the old cell.

Genetic Genealogy: Today, we are fortunate that the science of Genetic DNA now has evolved into consumer-based testing, which now is more accessible, and has opened up a new and growing field of genetic genealogy.  Genetic genealogy is the marriage of both traditional genealogy and genetic DNA findings.  One might say, “who cares” or “my family so messed up, I don’t want to know” but in time, you will.  In some point in your life you will have deeper questions, why you are the way you are or why I was born with these traits?  The sum of the DNA code, and mutations that make you unique, are the historical biological markers, and coded keys to your bloodline, Y-DNA Adam, and mtDNA Eve.  Your bloodline and pedigree are important, they are the road-map back into genealogical time, where your bloodline migrated from, and not only a genealogical map of your forebears but your relationship to the world you live in (who you are), and legacy to human history.

Traditional Genealogy:  The word Genealogy derived from the Greek word gena and logos (generation knowledge).  Genealogy is the study of generations of families through time or what is called “genealogical time” with such methods as genealogical charts or family trees based on supporting documentation of family surnames, vital records, church records, and U.S. Census Records (1800-1940).  Traditional genealogy is simply providing proof of your pedigree with legitimate and accepted records such as birth records, death certificates, church records, books, newspaper citations or any accepted forms of records. Nothing more required than good and valid research. Genealogy alone is the most difficult puzzle to solve in that there are many sand traps along the way such as surnames can change over time, confusion  of birth names, out of wedlock births, adoptions, erroneous vital records, lost or destroyed records,  Y-DNA line termination, collapse family tree, family lore verse facts, are in deed the most common challenges.

DNA Genealogy:  At the center of this discipline, there are three common types of tests when it comes to DNA Genealogy, Y-DNA, mtDNA, and Autosomal DNA.  Each test has a specific function, for example, Y-DNA tests are for your paternal line, which is confirmation of your Father’s direct line (Father, Grandfather, Great Grandfather, GG Grandfather, and so on to your Adam).   mtDNA tests are for your maternal line, which is confirmation of your Mother’s direct line (Mother, Grandmother, Great Grandmother, GG Grandmother, and so on to your Eve).  The Autosomal  DNA test confirms your distant DNA cousins, and can be resulted regardless of one’s birth sex.  With DNA Genealogy, there are broader and finer degrees of relationships, in that there are relationships that are only associated with broader Haplogroup family, but not with a finer degree of relationships in your family tree, and vice versa.

One receives twenty-three pairs of chromosomes from one’s Father, and twenty-three pairs of chromosomes from one’s Mother or forty-six chromosomes from both parents. Twenty-two of the twenty-three pairs of chromosome are Autosomal  DNA.  The twenty-third pairs are the sex chromosome that delineates between females and males.  Females have two copies of the X-chromosomes, while males have one X and one Y chromosome.  With this said, keep in mind that you will only inherit 50% of your parent’s Autosomal DNA, and your parents only inherited 50% from their parents, and so on.  So the farther you go back in genealogical time, the percentages of inherited Autosomal DNA decreases from your ancestors, however, your direct Y-DNA and mtDNA will remain constant over genealogical time.  DNA testing alone is not absolute, as like traditional genealogy, it can be tricky, as there is variability between labs, specimen quality, source references, algorithms, therefore, good, and valid paper research is necessary to go together with the DNA digital data.

DNA Testing Services

Types of Genetic DNA Tests

The Family Tree:  Autosomal DNA (maternal and paternal DNA relatives, deep ethnicity)  Twenty-two of the twenty-three pairs of chromosome are Autosomal  DNA.  The twenty-third pair are the sex chromosome that delineates between females and males.  Females have two copies of the X-chromosomes, while males have one X and one Y chromosome.  Again, an important reminder; you inherit 50% of your parent’s Autosomal DNA, and your parents only inherited 50% from their parents, and so on.  So the farther you go back in genealogical time, the percentages of inherited Autosomal DNA decreases from your ancestors.  You are a result of probability of all who came before you.

Father’s Direct Line:  Y-DNA (12 markers, 25 markers, 37 markers, 67, markers, 111 markers)  The sample STR Results without SNP tests below illustrates how to interpret your DNA results on Y-DNA 12 Marker Test.  The values listed in the fig. 1 Y-DNA 12 Marker Result represent the each sequence on location on the Y-DNA chromosome.  Lets take the location of DYS#426 based on the sequence below:

TGTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGAC…

As you can see from the DNA sequence above, there are 12 sets of GTT, and this value counted under DYS# 426 in fig.1.  The same concept would apply to the 25, 37, 67, and 111 Y-DNA Markers Tests as well.  As a rule of thumb, the higher the Y-DNA Marker test, the more confidence is place on the matches as a direct relationship to your paternal line.

fig. 1 Y-DNA 12 Marker Result:

DYS#

393

390

19**

391

385a

385b

426

388

439

389-1

392

389-2

Alleles

12

24

14

11

11

14

12

12

13

13

13

29

**Also known as DYS#394

Mother’s Direct Line:  mtDNA (HVR1 and HVR2, Full Sequence)  The standard for mtDNA genome based on the Cambridge Reference Sequence (CRS). All the differences between your mtDNA and the CRS returned as the results. These results are predictive, and used to estimate one’s mtDNA Haplogroup.  Roughly, estimates the amount of time to which individuals share a most recent common ancestor (MRCA).  The alphabet letter designation represent the DNA code of the Adenine, Thymine, Guanine, and Cytosine.

HVR 1 DIFFERENCES FROM rCRS

16111T

16223T

16290T

16319A

16335G

16526

HVR 2 DIFFERENCES FROM rCRS

64T

73G

146C

153G

235G

263G

309.1C

315.1C

522-

523-

SNP Testing:  SNP (Single-nucleotide polymorphism) tests can reveal the changes in the single nucleotide within the DNA sequence.  Over time, the DNA makes copies of itself, and this process can result in errors known as mutation or polymorphisms.  SNP tests can determine a person’s exact haplogroup, and subclades if available or in other words, one’s deep ancestry.

Haplogroups:   From the Greek word haploûs, one fold, single, simple. The definition of haplogroup is a genetic population group of people who share a common ancestor either on the patrilineal or matrilineal line. Haplogroups are assigned letters of the alphabet, and refinements consist of additional number and letter combinations to specifically population sets.   Please keep in mind, that Haplogroups have very broad trees and branches of human migration over tens of thousands of years.  DNA and Y-SNP (single nucleotide polymorphism) testing can define your specific haplogroup that you inherited from your mother and father.  The International Society of Genetic Genealogy (ISOGG) maintains current ongoing research of both Y-DNA and mtDNA haplogroups and subclades .

In some cases, like Family Tree DNA’s Big Y Test result can pinpoint one’s paternal haplogroup to a specific subclade, predictive region, and age.  My example, R-Y23968 is a haplogroup that is estimated to be 4,200 (YBP) years before present. This specific haplogroup R-Y23968 which is a subclade of R-DF27 originated in Europe, since an ancient specimen from Quedlinburg, Germany from about 4246-4156 years ago tested positive for R-DF27.  The general consensus among genetic genealogists, the population set specific to the Americas with Haplogroup R-D27 is generally thought of an ancient Iberian group, which left Spain after 1492. However, R-DF27 is a very common Y-chromosome clade of paternal lineages in Western Europe, and a specific subclade for Spain will be future possibility as more data is acquired over time.

Y-DNA Human Migration (Haplogroups) – Source: FTDNA 
Thousands of Years Ago

A 60 G 20 O3 35
B 50 H 30 P 35
CT 50 I 25 Q 20
D 50 J 25 Q1a3a 10
E 50 K 40 R 30
E1b1a 20 L 30 R1a 10
E1b1b 20 M 10 R1b 25
C 50 N 10 S 10
F 45 O 35 T 10

mtDNA Human Migration (Haplogroups)  – Source: FTDNA 
Thousands of Years Ago

A 30 J 40 R 50
B 50 K 25 R0 30
C 20 L0 >100 T 20
D 25 L1 >100 U 50
F 50 L2 80 V 15
H 30 L3 70 W 20
HV 30 M 60 X 30
I 15 N 50 Z 30

DNA Tools: ISOGG Autosomal DNA_tools

Credits and Sources:  Arizona State University, Blaine Bettinger (www.thegeneticgenealogist.com), Family Tree DNA (FTDNA), 23andme, Genetic Science Learning Center at the University of Utah, Queen Mary University of London , The International Society of Genetic Genealogy (ISOGG), University of Arizona, U.S. National Library of Medicine, National Institute of Health, Wikipedia

All Rights Reserved  Genetic Genealogy – Children of the Sun © Richard Anthony Peña 2017

#DNA*Genealogy

This entry was posted in Genealogy DNA and tagged , , , , , , , , , , , , . Bookmark the permalink. Both comments and trackbacks are currently closed.