• Works on Paper and Piano

Genetic Genealogy: Children of the Sun


In the night sky, the stars form patterns of shapes, and twisting outlines, like a jeweled crown of thorns, with points of Jupiter, Mars, Saturn, Sirius, and Venus.  As the stars, and constellations move across the darkness of the night, the starry crown twists and turns, and forms a ladder leading us into the depths of the heavens, from where all heavenly resources of the earthly elements originated from.  All that makes life possible such as carbon, hydrogen, oxygen, nitrogen, and phosphorus, along with all the earthly elements connects us, in turn, unifies all life with the heavens, the constellations, and even to our own sun.  As these chemical elements are the bonds between earthly life, and to the rest of the universe, in which the physicality of deoxyribosenucleic acid could not be possible without its rich heritage to the rest of the universe, as it is this heritage, which is the physical genesis, the fabric of human, animal, and plant life.

Children of the Sun

We are the children of the light.
The crimson sun guides us.
Remember us for we lived for beauty.
Remember us for we lived for love.
Remember us for we lived for originality.
As the light of time leaves us behind,
Remember us.

We are the children of the darkness.
The moonlight so blue guides us.
Remember us for we lived for discord.
Remember us for we lived for hate.
Remember us for we lived for revolution.
As the darkness of time leaves us behind,
Remember us. 

Children of the Sun © Richard Anthony Peña 

The Code of Life

The code of life begins with cells that are the basic building blocks of all living things. The human body in its formality, is composed of trillions of cells, and provides structure for the body, takes in nutrients, convert those nutrients into energy, and carry out specialized functions.  It is here, in the cells that contain the body’s hereditary material, called DNA, or deoxyribonucleic acid, which is the hereditary chemical material in humans, and almost all living organisms.  Most of all DNA is located in the cell nucleus (nuclear DNA), but also there is small amount of DNA can also be found in the mitochondria (mitochondrial DNA or mtDNA).

The Cellular Structure

   Cytoplasm:  Within cells, the cytoplasm is made up of a jelly-like fluid (called the cytosol) and other structures that surround the nucleus.

  Cytoskeleton:  The cytoskeleton is a network of long fibers that make up the cell’s structural framework. The cytoskeleton has several critical functions, including determining cell shape, participating in cell division, and allowing cells to move. It also provides a track-like system that directs the movement of organelles and other substances within cells.

∃   Endoplasmic Reticulum (ER):  This organelle helps process molecules created by the cell. The endoplasmic reticulum also transports these molecules to their specific destinations either inside or outside the cell.

∃   Golgi Apparatus:  The Golgi apparatus packages molecules processed by the endoplasmic reticulum to be transported out of the cell.

   Lysosomes and Peroxisomes:  These organelles are the recycling center of the cell. They digest foreign bacteria that invade the cell, rid the cell of toxic substances, and recycle worn-out cell components.

∃   Mitochondria:  Mitochondria are complex organelles that convert energy from food into a form that the cell can use. They have their own genetic material, separate from the DNA in the nucleus, and can make copies of themselves.

∃   Nucleus:  The nucleus serves as the cell’s command center, sending directions to the cell to grow, mature, divide, or die. It also houses DNA (deoxyribonucleic acid), the cell’s hereditary material. The nucleus is surrounded by a membrane called the nuclear envelope, which protects the DNA, and separates the nucleus from the rest of the cell.

∃   Plasma Membrane:  Thee plasma membrane is the outer lining of the cell. It separates the cell from its environment and allows materials to enter and leave the cell.

∃   Ribosomes:  Ribosomes are organelles that process the cell’s genetic instructions to create proteins. These organelles can float freely in the cytoplasm or be connected to the endoplasmic reticulum (see above).

Sources:
i.) U.S. National Library of Medicine
ii.) The Genetic Science Learning Center at the University of Utah offers an interactive introduction to cells and their many functions.
iii.) Arizona State University’s “Ask a Biologist” provides a description and illustration of each of the cell’s organelles.
iv.) Queen Mary University of London allows you to explore a 3-D cell and its parts.
v.) The Biology Project: University of Arizona

DNA Structure:

Doxyribosenucleic Acid consists of two parts; Deoxyribose is a ribose sugar without oxygen element, and Nucleic Acid makes-up the rest of the molecule. The DNA backbone is made-up of a sugar (deoxyribose) phosphate, and the bases attach onto the sugars, and stick out almost at right angles into the center of the helix. The bases contain C, H, O, and N.

Double Helix Structure:

  • Right-handed Double Helix
  • Four bases which specifically base pair in a Watson and Crick formulation.
    AT (Adenine – Thymine always pair together)
    G-C (Guanine – Cytosine always pair together)
  • There are two Purine bases (single rings) – A and G
  • There are two Pyrimidines (double rings) – T and C
  • The helix is the same width all the way down (about 2 nanometers) due to Purines and Pyrimidines bases paring.
  • DNA sequence is listing the bases along either one of the two sides. For example, one side might read as T G T T C G T C, etc.
  • There are minor and major grooves, caused again by the different sized bases. The major grooves are allowing enzymes to probe the bases, and to bind.

                         DNA Double Helix

A segment of DNA contains the code used to synthesize protein, chromosomes contains hundreds to thousands of genes. Every human cell has 23 pairs of chromosomes, total of 46 chromosomes.  Human traits are gene-determined characteristic, and often determined by more than one gene. There are traits caused by abnormal genes, which are inherited or are the result of a new mutations occurring during one’s lifetime.  Proteins are the most important class of bio-molecules in the body. Proteins are the building blocks for muscles, connective tissues, skin, and other biological formations. Proteins also are needed to make enzymes.  Enzymes are complex proteins, which carry out nearly all chemical processes, and reactions within the body.  Your body produces tens of thousands of different kinds of enzymes, in which these types and amounts of proteins govern your entire body.  The syntheses of proteins are controlled by genes, which are contained in chromosomes.  An important characteristic of DNA is that it can replicate, or simply make copies of itself. Each strand of DNA in the double helix serves as a pattern for duplicating the sequence of bases. This is important when cells divide because each new cell needs to have an exact copy of the DNA present in the old cell.

Genetic Genealogy: Today, we are fortunate that the science of Genetic DNA now has evolved into consumer-based testing, which now is more accessible, and has opened up a new and growing field of genetic genealogy.  Genetic genealogy is the marriage of both traditional genealogy and genetic DNA findings.  One might say, “who cares” or “my family so messed up, I don’t want to know” but in time, you will.  In some point in your life you will have deeper questions, why you are the way you are or why I was born with these traits?  The sum of the DNA code, and mutations that make you unique, are the historical biological markers, and coded keys to your bloodline, Y-DNA Adam, and mtDNA Eve.  Your bloodline and pedigree are important, they are the road-map back into genealogical time, where your bloodline migrated from, and not only a genealogical map of your forebears but your relationship to the world you live in (who you are), and legacy to human history.

Traditional Genealogy:  The word Genealogy derived from the Greek word gena and logos (generation knowledge).  Genealogy is the study of generations of families through time or what is called “genealogical time” with such methods as genealogical charts or family trees based on supporting documentation of family surnames, vital records, church records, and U.S. Census Records (1800-1940).  Traditional genealogy is simply providing proof of your pedigree with legitimate and accepted records such as birth records, death certificates, church records, books, newspaper citations or any accepted forms of records. Nothing more required than good and valid research. Genealogy alone is the most difficult puzzle to solve in that there are many sand traps along the way such as surnames can change over time, confusion  of birth names, out of wedlock births, adoptions, erroneous vital records, lost or destroyed records,  Y-DNA line termination, collapse family tree, family lore verse facts, are in deed the most common challenges.

DNA Genealogy:  At the center of this discipline, there are three common types of tests when it comes to DNA Genealogy, Y-DNA, mtDNA, and Autosomal DNA.  Each test has a specific function, for example, Y-DNA tests are for your paternal line, which is confirmation of your Father’s direct line (Father, Grandfather, Great Grandfather, GG Grandfather, and so on to your Adam).   mtDNA tests are for your maternal line, which is confirmation of your Mother’s direct line (Mother, Grandmother, Great Grandmother, GG Grandmother, and so on to your Eve).  The Autosomal  DNA test confirms your distant DNA cousins, and can be resulted regardless of one’s birth sex.  With DNA Genealogy, there are broader and finer degrees of relationships, in that there are relationships that are only associated with broader Haplogroup family, but not with a finer degree of relationships in your family tree, and vice versa.

One receives twenty-three pairs of chromosomes from one’s Father, and twenty-three pairs of chromosomes from one’s Mother or forty-six chromosomes from both parents. Twenty-two of the twenty-three pairs of chromosome are Autosomal  DNA.  The twenty-third pairs are the sex chromosome that delineates between females and males.  Females have two copies of the X-chromosomes, while males have one X and one Y chromosome.  With this said, keep in mind that you will only inherit 50% of your parent’s Autosomal DNA, and your parents only inherited 50% from their parents, and so on.  So the farther you go back in genealogical time, the percentages of inherited Autosomal DNA decreases from your ancestors, however, your direct Y-DNA and mtDNA will remain constant over genealogical time.  DNA testing alone is not absolute, as like traditional genealogy, it can be tricky, as there is variability between labs, specimen quality, source references, algorithms, therefore, good, and valid paper research is necessary to go together with the DNA digital data.

DNA Testing Services

Types of Genetic DNA Tests

The Family Tree:  Autosomal DNA (maternal and paternal DNA relatives, deep ethnicity)  Twenty-two of the twenty-three pairs of chromosome are Autosomal  DNA.  The twenty-third pair are the sex chromosome that delineates between females and males.  Females have two copies of the X-chromosomes, while males have one X and one Y chromosome.  Again, an important reminder; you inherit 50% of your parent’s Autosomal DNA, and your parents only inherited 50% from their parents, and so on.  So the farther you go back in genealogical time, the percentages of inherited Autosomal DNA decreases from your ancestors.  You are a result of probability of all who came before you.

Father’s Direct Line:  Y-DNA (12 markers, 25 markers, 37 markers, 67, markers, 111 markers)  The sample STR Results without SNP tests below illustrates how to interpret your DNA results on Y-DNA 12 Marker Test.  The values listed in the fig. 1 Y-DNA 12 Marker Result represent the each sequence on location on the Y-DNA chromosome.  Lets take the location of DYS#426 based on the sequence below:

TGTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGAC…

As you can see from the DNA sequence above, there are 12 sets of GTT, and this value counted under DYS# 426 in fig.1.  The same concept would apply to the 25, 37, 67, and 111 Y-DNA Markers Tests as well.  As a rule of thumb, the higher the Y-DNA Marker test, the more confidence is place on the matches as a direct relationship to your paternal line.

fig. 1 Y-DNA 12 Marker Result:

DYS#

393

390

19**

391

385a

385b

426

388

439

389-1

392

389-2

Alleles

12

24

14

11

11

14

12

12

13

13

13

29

**Also known as DYS#394

Mother’s Direct Line:  mtDNA (HVR1 and HVR2, Full Sequence)  The standard for mtDNA genome based on the Cambridge Reference Sequence (CRS). All the differences between your mtDNA and the CRS returned as the results. These results are predictive, and used to estimate one’s mtDNA Haplogroup.  Roughly, estimates the amount of time to which individuals share a most recent common ancestor (MRCA).  The alphabet letter designation represent the DNA code of the Adenine, Thymine, Guanine, and Cytosine.

HVR 1 DIFFERENCES FROM rCRS

16111T

16223T

16290T

16319A

16335G

16526

HVR 2 DIFFERENCES FROM rCRS

64T

73G

146C

153G

235G

263G

309.1C

315.1C

522-

523-

SNP Testing:  SNP (Single-nucleotide polymorphism) tests can reveal the changes in the single nucleotide within the DNA sequence.  Over time, the DNA makes copies of itself, and this process can result in errors known as mutation or polymorphisms.  SNP tests can determine a person’s exact haplogroup, and subclades if available or in other words, one’s deep ancestry.

Haplogroups:   From the Greek word haploûs, one fold, single, simple. The definition of haplogroup is a genetic population group of people who share a common ancestor either on the patrilineal or matrilineal line. Haplogroups are assigned letters of the alphabet, and refinements consist of additional number and letter combinations to specifically population sets.   Please keep in mind, that Haplogroups have very broad trees and branches of human migration over tens of thousands of years.  DNA and Y-SNP (single nucleotide polymorphism) testing can define your specific haplogroup that you inherited from your mother and father.  The International Society of Genetic Genealogy (ISOGG) maintains current ongoing research of both Y-DNA and mtDNA haplogroups and subclades .

In some cases, like Family Tree DNA’s Big Y Test result can pinpoint one’s paternal haplogroup to a specific subclade, predictive region, and age.  My example, R-Y23968 is a haplogroup that is estimated to be 4,200 (YBP) years before present. This specific haplogroup R-Y23968 which is a subclade of R-DF27 originated in Europe, since an ancient specimen from Quedlinburg, Germany from about 4246-4156 years ago tested positive for R-DF27.  The general consensus among genetic genealogists, the population set specific to the Americas with Haplogroup R-D27 is generally thought of an ancient Iberian group, which left Spain after 1492. However, R-DF27 is a very common Y-chromosome clade of paternal lineages in Western Europe, and a specific subclade for Spain will be future possibility as more data is acquired over time.

Y-DNA Human Migration (Haplogroups) – Source: FTDNA 
Thousands of Years Ago

A 60 G 20 O3 35
B 50 H 30 P 35
CT 50 I 25 Q 20
D 50 J 25 Q1a3a 10
E 50 K 40 R 30
E1b1a 20 L 30 R1a 10
E1b1b 20 M 10 R1b 25
C 50 N 10 S 10
F 45 O 35 T 10

mtDNA Human Migration (Haplogroups)  – Source: FTDNA 
Thousands of Years Ago

A 30 J 40 R 50
B 50 K 25 R0 30
C 20 L0 >100 T 20
D 25 L1 >100 U 50
F 50 L2 80 V 15
H 30 L3 70 W 20
HV 30 M 60 X 30
I 15 N 50 Z 30

DNA Tools: ISOGG Autosomal DNA_tools

Credits and Sources:  Arizona State University, Blaine Bettinger (www.thegeneticgenealogist.com), Family Tree DNA (FTDNA), 23andme, Genetic Science Learning Center at the University of Utah, Queen Mary University of London , The International Society of Genetic Genealogy (ISOGG), University of Arizona, U.S. National Library of Medicine, National Institute of Health, Wikipedia

All Rights Reserved  Genetic Genealogy – Children of the Sun © Richard Anthony Peña 2017

#DNA*Genealogy

Posted in Genealogy DNA | Tagged , , , , , , , , , , , , | Comments closed

Elegy: Children of the Sun


In the night sky, the stars form patterns of mythical shapes, and twisting outlines, like a jeweled crown of thorns, with points of Jupiter, Mars, Saturn, Sirius, and Venus, that shine beyond the horn of the imagination.  As the stars, and constellations move across the darkness of the night, the starry crown twists and turns, forming a ladder leading us into the depths of the heavens, far beyond our time. Oh, Children of the Sun, remember us.

We are the children of the light.
The crimson Sun guides us.
Remember us for we lived for beauty.
Remember us for we lived for love.
Remember us for we lived for originality.
As the light of time leaves us behind..
Remember us.

We are the children of the darkness.
The moonlight so blue guides us.
Remember us for we lived for discord.
Remember us for we lived for hate.
Remember us for we lived for revolution.
As the darkness of time leaves us behind..
Remember us. 

Alas there maybe fire, Alas there maybe ice, codes of heaven and hell.
Oh fiery Venus, cold distant warrior of Mars, and hungry Saturn will.
Everything falls in between.
We are the children of beauty and discord.
We are the children of love and hate.
We are the children of originality and rebellion.
Remember us.
We are the Children of the Sun.


Children of the Sun © Richard Anthony Peña 2017

Posted in Poems | Comments closed

Francisco José de Goya y Lucientes: Looking through the darkly painted mirror; Disasters of War, Witches’ Sabbath, and The Colossus


Madrid, Spain 1793:               

 The chill of the night air was thick with the sweet smell of burning wood, smoky leaves, and the familiar aroma of roasted vegetables, black pork, and paella, which hung in the air like a veiled fog in the Spanish autumn evening.  The stars cut through the night sky, reveal their beauty not of daylight but all things imaginable, luminous, and unseen by the human eye, like a trick of light. From a far, a single candle flickers, and illuminates the house window of Francisco José de Goya y Lucientes.  The calm of the night air becomes anxious by sounds of gasping and coughing from inside the house where Goya is facing down in his cot, suffering from heat of fever, soaked in sweat, and it is here, Goya experiences feverish and delirious dreams.  Whispering to himself softly, and repeatedly, “My name is Francisco José de Goya y Lucientes, the greatest painter of all the Kingdom of Spain,” once more Goya begins to dream, again, and again.

Starry, starry night, mysterious sprites, dancing as muses throughout the night, with the moon so bright, oh Iberian moon light, call the ancient ones, and show them all that is not of daylight.

Goya laughs in his sleep and whispers; “Spain the crossroads of enchantment, my homeland of superstitions, has she not learned anything from the years of the enlightenment?  I Goya, the greatest painter of all of Spain, will paint them for what they are; I will paint them their world, a world of ignorance, superstitions, fear, and terror.”

 Goya continues to dream, and finds himself walking down old and ancient Roman Hispania country road in the middle of the night with a mere candle lantern, stars in the night, so bright.  As Goya approaches the steep of a hill, rubs his eyes in disbelief; he suddenly drops to his knees not to be discovered, as at the top of the hill, three witches in flight, floating in mid-air, hovering high above the peak of the hill, holding their victim in the night, feasting on a poor soul’s life.  The victim’s body was as if draping silk cloth in their embrace.  Goya could hear crying, and his hands began to shake as the crying becomes louder, and louder.

 Below the hovering witches, a dark silhouette formed, an old peasant appeared, hunched down, head covered only to see the narrow path ahead down the hill, and signs with his hands to warn off the evil eye.  The witches and their victim dissipate in thin air, and are no longer reality.  The peasant and his crying donkey are obvious now in the candle light as they come down the hill.  Goya stops the old peasant and asks, “What is your donkey’s name, old man?” The peasant replies,”his name is Ignorance, my friend, and yours?” Goya shakes his head, and then grins widely while wiping his eyes.

 The old peasant turns his head back towards Goya, and calmly states, “I cannot hear your answer, I cannot hear you, my friend.”  Goya whispers back to the old peasant, “I sense something unnatural, something haunting.”  Goya wakes up out of his dream with sweat beaded on his forehead, and stumbles frantically around the room, banging tin cups, plates, or anything he could get his hands on to make noises, but only detects an unnatural and haunting silence.  The haunting silence was not a dream but a muse of a deep and dark human truth.

Francisco José de Goya y Lucientes (b. 1746 – d.1828)    Goya was born in Fuendetodos, Spain, a village slightly south of Zaragossa in the providence of Aragon.   Goya’s parents were Jose Francisco de Paula Goya, he was a tradesman, a master gilder.  His mother, Gracia Lucientes, and she would also mother Goya’s siblings, Rita (b.1737), Jacinta (b.1743), Mariano (b.1750) and Carmilo (b.1752).  Later Goya’s family moved to Zaragossa, and there at age 14 he studied under José Luzán y Martinez (b.1710 – d. 1785).   Goya, before long moved to Madrid, in 1763 joined the studio of the brothers of Francisco (b.1734 – d.1795) and Ramón Bayeu y Subías (b.1746 – d.1793) where he met Josefa Bayeu (d.1812), their sister.   For a brief two-year period, Goya visited and studied in Italy in 1770, after two failed attempts in drawing competitions at the Real Academia des Bellas Artes in San Fernando.  In 1773, he married Josefa, and their life together characterized by a series of pregnancies, and number of miscarriages.  Her nickname was “Pepa”, and she gave Goya seven children to him, only one of which lived past infancy and into adulthood; Xavier Goya (b.1784).

 Goya artistically matured under later reign of the House of Bourbon of King Charles III and King Charles IV during the Spanish Enlightenment, and then under Ferdinand VII, with the exception of the brief five years (1808 – 1813) of the House of Bonaparte of Joseph I.  In 1786, Goya became a court painter to the Spanish Crown; portrait commissions by the Spanish aristocracy mark these early works.  Also during this period 1774, Goya developed a relationship with Anton Raphael Mengs (b. 1728 – d. 1779) through the Royal workshops.  Mengs asked Goya to create a number of Rococo style tapestry cartoons designed for the royal palace.  Throughout his life and career, Goya was a secretive man, although letters and writing survived, we know comparatively little about his external and internal thoughts, other than his paintings and prints, and these are powerful biographical artifacts of the man, as we come to know as Francisco José de Goya y Lucientes.

Into Silence of Darkness:

 In 1793, Goya suffered a severe and unknown illness, which left him completely deaf.  However, the onset of deafness was not an obstacle in Goya’s ability to social climb, in 1795, appointed to Director of the Royal Academy, and in 1799 Goya became Primer Pintor de Cámara, the highest rank for a Spanish court painter.  However, his works became progressively darker, and pessimistic about the world around him, his canvas works, mural painting, printmaking, and drawing began to reflect bleak outlook on psychological and social-political level.   The onset of deafness also had a deep physiological impact on Goya, as deafness would be life changing.  From this point, his work evolved into a dichotomy of light and dark works of art.  Like a two-sided coin, where one side of the coin is external, representational, commissioned works of portraiture of royals and of the highborn, while the other side of the coin, portrayed a more darker, internalized, emotional, intellectual, imaginative, and social-political works of art.

Goya, Napoleon, and the Peninsular War:

 In 1807, Napoleon invaded and occupied Spain.  Goya remained in Madrid during the Peninsular War, and the terror of the war changed Goya’s work and his outlook on human behavior.  Goya was perceptive enough to stay out of the politics of harm’s way, by holding his cards to his chest, and only displayed cards that were in his best interest.  Goya pledge allegiance to Bonaparte, and painted for the French power elite and highborn.  In 1811, Goya was awarded the Royal Order of Spain.  In the autumn of 1814, Napoleon’s grip on Spain was brought to an end, and a new King was installed, Ferdinand VII, who was unlike his father Charles IV, who was a true believer in the Enlightenment.  Ferdinand VII was the complete opposite of his father and became an absolute monarch during the reign, which set the stage between two political adversaries, it was the Liberals verses the Monarchist, a political struggle that dominated his time.

Ferdinand VII reign was one of terror, as he revoked the Constitution and brought back the Inquisition.  Ferdinand VII reportedly once told Goya, “You deserve to be garroted, but you are a great artist, so we forgive you.” Such a statement one would not to take so lightly from the King, as to be garroted was a horrific and barbaric act, as many others were not so lucky in their pursuit for a constitutional state and freedoms. When Goya was questioned about his loyalty to the French occupiers, Goya demonstrated his allegiance by commemorating Spain’ uprising against the French regime with two paintings. In 1814, Goya answered his allegiance to House of Bourbon, King Ferdinand VII, by producing two powerful paintings about the French occupation, The Second of May 1808 and The Third of May 1808; as the dates are synonymous with Goya, and the history of painting.

  During the same period, Goya produced “Disasters of War” along with other works from his mid-career period includes the Los Caprichos and Los Disparates print series, and a variety of paintings depicting insanity, mental asylums, witches, fantastical creatures, religious and political corruption, all that were private observations, anxieties, and fears of a culture of ignorance and superstition.  Not to mention, fate of Goya’s own physical and mental state to endure.  Toward the end of his career and life, Goya continues to produce boldly with the so-called, Black Paintings of 1819–1823, applied oil on the plaster walls of his house the “Quinta del Sordo” (house of the deaf man) signifying his isolation, and disillusion with the Spanish political and social life.  In 1824, Goya leaves Spain for the French city of Bordeaux, accompanied by his maid and companion, Leocadia Weiss.  There he completed his last and final series, La Tauromaquia.  Soon after, Goya suffered a stroke, which left him paralyzed on his right side, and failing eyesight.  Goya died in Bordeaux, France on April 16, 1828 at age eighty-two.  Spain would never forget one of their greatest artists, Francisco José de Goya y Lucientes; his body re-interred in Spain in 1901, moved beneath the floor of the Royal Chapel of San Antonio de la Florida in Madrid, Spain.

 Before the life and times of Goya, Hieronymus Bosch (c.1450 – d.1516) and Pieter Brueghel the Elder (c.1525 – d.1569) both Renaissance period painters, also come to mind into the historical window of view, as they dealt into the subject matter of imaginative, otherworldly, and unsavory depiction of hellish human landscapes as social-religious acceptable doctrines of their day.  However, this was not the case with Goya, his subversive works without a doubt put his life on the line with the Spanish Inquisition more than once.  If it was not for his royal and aristocratic connections to pull strings, one can only speculate the outcome from the judicator of the inquisition, and the impact of such an adjudication of the inquisition on the life and physical works of Francisco José de Goya y Lucientes.

 Critics and historians alike often described Goya’s works during his black period as journey into his private madness and psyche of deafness, but his canvas work, murals, printmaking, and drawings speak of another truth of ages, a deep, dark human truth of ignorance, superstitions, corruption, slavery, fear, war, and terror.  Goya was artistically matured master of iconic imagery; he used the ideals of the enlightenment as the symbolic framework or the iconology in his dark paintings, murals, printmaking and drawings.  Goya was indeed recognized as a great artist by both the Spanish and French aristocracy of his day for his portrait work.  However, what ultimately transports Goya’s artistic reputation over historic time, are the continued and collective interests of his darker masterpieces, and his ability to transport his most inner thoughts of the social-political world around him, in a unique and highly personalized visual form, with cryptic, iconic, and subversive symbolism of the enlightenment. Goya’s critical and moral eye paints an age of colossal turbulence, disasters, and ignorance, reminding future generations to come; they too are not exempt from deep and dark human truths.

Disasters of War:

 Long before the age of photography and the development of war photography, there was Goya’s master plates and prints, Disasters of War (Los desastres de la guerra), a series of 82 prints created between 1810 and 1820, which never were published during his lifetime. The original name for the series derived from his own handwriting from the proofs, “Fatal consequences of Spain’s bloody war with Bonaparte, and other emphatic caprices (Fatales consequencias de la sangrienta guerra en España con Buonaparte, y otros caprichos enfáticos).”  The series of plates portray Goya’s persistent memory of the Peninsular War from 1808 to 1814, and the subsequent setbacks to liberal causes following the restoration of the Bourbon monarchy in 1814.  At age 62, Goya began work on the plates, and the series of Disasters of War divided into three thematic grouping; war, famine, political-cultural vignettes.  The final plates kept in safe storage and not published until 35 years after his death, in 1863.

 Some surmise the protracted gap in publishing the series only then, after his death was considered politically safe for distribution, with public exposure to criticizing both the French, and restored Spanish monarchy of the Bourbons.  Goya’s true intention to publish the series is indeed unknown but the rationale of the protracted publishing date seems as reasonable counsel, considering the possible risks to Goya, and his patrons.  The Disasters of War represents a deep, dark, human truth about human aggression, and its terror. The human narrative of human aggression, and its associated outcomes has shaped the human genome, transformed human migration patterns throughout history as we know it today, including our humanity of ethnic, culture, religious, political, and national identities. The theater of human aggression becomes more complex in the role it plays, as the facts are played out over time in transforming the world of humans. Such aggression and counter-aggression become collective mark in our DNA, and human consciousness.  Like the natural world, we swim in a Darwinian ocean of natural selection, leaving survival of the fittest, for the better or worse.

Seeds of Conflict:

 Embedded in Human DNA are small amounts of Homo neanderthalensis Mitochondrial DNA, and such findings are based on the research performed by Lawrence Berkeley National Laboratory and the Joint Genome Institute in 2006.  The published findings and evidence point to Homo sapiens and Homo neanderthalensis life cycles overlapped, and interbreeding occurred.  No one knows exactly what led to the extinction of the Homo neanderthalensis. What we do know that Homo neanderthalensis came out of Africa into Eurasia, and then migrated from Eurasia to the far reaches of Western Europe into mostly the regions of France and Spain, then succumbed to extinction.  In many ways Homo neanderthalensis was equally or more prepared for survival than their counterpart Homo sapiens.  Homo neanderthalensis had short, robust stocky build, were courageous, and fearless hunters.  They exhibited ability to use tools, made clothes, jewelry, hunting apparatuses, took care of their sick, wounded, and buried their dead.  Their cave art in France and Spain are legendary powers of observations.

 So why did Homo neanderthalensis succumbed to extinction? There are two primary hypotheses debated in the scientific community as to the demise of Homo neanderthalensis, failure in adaptation to climate change, and the other, competing for resources along with Homo sapiens in a ever changing environment. Although, there is no significant evidence in the fossil record linking climate change directly to the demise of Homo neanderthalensis, however, climate change is indeed considered one of the usual suspects, and contributing factors, over longer periods of time.  If human history is any indication, the latter of natural selection and survival of the fittest for competing resources appears more plausible for Homo neanderthalensis extinction.  As competition between Homo sapiens and Homo neanderthalensis for resources such as water, food, reproduction, safe habitats, and from the elements, all become the catalyst for conflict, leading to other risks, such as the dangers of migration and the challenges of adaptation, where if unsuccessful in migration and adaptation, the probability of extinction of the genetic line becomes a reality.

 Competition is no stranger in the natural world for all other species, so why would Homo sapiens and Homo neanderthalensis be exempt from the successes and failures of natural selection? Aggression and counter-aggressions are elements required for incremental evolutionary change and adaptation; sink or swim.  Could have not the traits of aggression and counter-aggression thinking have given our early Homo sapiens ancestors an edge over Homo neanderthalensis? Along with Homo sapiens’ instincts to take fewer risks relative to Homo neanderthalensis, by lowering Homo sapiens’ mortality rates comparatively?  There is a lot said about Homo sapiens’ ability to adapt to changing environmental resources as both hunters and gathers but could have Homo sapiens been more successful procreating at much higher rates, in the end, overcame Homo neanderthalensis by the numbers?

 The narrative of Homo neanderthalensis is one comprised of both facts, and conjecture, simply because we do not know if the extinction of Homo neanderthalensis was by climate change, disease, genocide, starvation, cannibalism, or inability to adapt to dire changes over time.  The correlation of the human haplogroup migration patterns over thousands of years along with the historic record mirrors the story of human struggles, conflicts, and branches that terminated with extinction.  The same human narrative or algorithms appear cycling over, and over again; aggression and counter-aggression, habitat change, migration, adaptation, competition for resources, and the inevitable disasters of war. Goya’s disaster of war is a reminder, an allegorical vision, of all what humans are capable of that is basic or primal in our nature, embedded as inherited markers that come along in time, and recorded in our (SNP) single nucleotide polymorphism through our human genome.  If not Goya, art, or history satisfies the question, and then look no further but to the present.

Afghanistan, Iraq, Syria and the Levant:

 For some, the loss of art, culture, and history, is inability to view the present or even visualize the future, for others, the art, culture, and history are threats to their control, and ability to force their covenant upon others, as facts, and empirical thinking can be critical to all religions and governing bodies.  If the terror, and madness of the disasters of war can be put into a contemporaneous view, not as art, but as historic significance, then take an empty vessel, add the mixture of religion, ignorance, malice, and desire for power.  Stir violently, and you have the current nation-states of Syria, Afghanistan, and Iraq, with complicity to fuel regional conflict and civil war from Iran, Egypt, Pakistan, Saudi Arabia, United States, Russia, and Turkey.   In the cradle of Levant, and surrounding regions, the birth of Abrahamic religions began, and developed into the religions of the scripts, the Old Testament, New Testament, and the Quran.

 Today, the internal struggles within, and between the Abrahamic religions, and more specifically to the more isolated and smaller demographic segment populations within the sects of Islam, has transpired into a sadistic amalgamation of terror, and what can only be described as a disasters of war in Syria, and the greater Levant region.   Religious righteousness combined with acts of amorality, reckless brutality, murderous cowardliness, intolerance, and disdain of human life as precious and God-given, are the precise words that come to mind describing of Muslim violence against other Muslims, Christians, Jews, Kurds, and other ethnicities. Such barbaric acts we are witnessing in Syria, Iraq, Afghanistan, and the greater region, are categorically acts of terror, and to a finer degree, genocide.  Here in this region, are the sins of disasters of war.  As the deliberate intent of religious and ethnic cleansing by the perpetrators that pretentiously use mantra of the defenders of a Abrahamic sect of religion, by malice, senseless acts of murdering of innocent and defenseless civilians of all ages, regardless of Abrahamic code.

 The perpetrators of these acts are demographically young to middle-aged men with no legitimate economic future prospects, but turn to crime and declension, creating disasters of war on all that oppose their power, and control, all for a paycheck or the love of money.  Acting with sense of false bravado with their murderous acts in places like Aleppo, Mosul, Al-Raqqah or wherever, to perpetuate their unholy terror.  They peculate their own religion, stealing and taking scripts out context to justify their crimes, with acts of terror such as murder, suicide bombings, torture, starvation, thievery, slavery, and prostitution, all with the intent to create a pseudo nation-state.  No legitimate followers of the Abrahamic tradition or eastern religion for that matter condone such sins; such is the murderous and immoral cowardliness in the face of God, and the heavens.  Oh wisdom lost in antiquity, in Spain’s Islamic Golden Age, where all three of Abrahamic faiths were unified, Christian Monks, Jewish Rabbis, and Muslim Imams of the Abrahamic scripts were of one mind in Abrahamic code, and together they prayed, collaborated, and respected each Abrahamic faith.  Of this antiquity of Abrahamic union of three, they leave us with this line of code; there are seven levels of ascension or declensions of human will, four sectors of the heavens, one God.

Saladin and Richard I, the Lionheart:

 Long ago in time, paralleled in this same ancient region of the world, An-Nasir Salah ad-Din Yusuf ibn Ayyub (صلاح الدين يوسف بن أيوب) or historically known as Saladin to the West (b.1137 – d. March 1193), was born in the city of Tikrit, which now in modern-day Iraq.   Saladin came from a family of Sunni Muslims, and of Kurdish ancestry, served as Emir and Sultan of Egypt, conquered Syria, Yemen, and parts of North Africa.  Saladin considered a legendary and prominent military figure in Muslim, Arab, Turkish, Kurdish, and European histories.  It was during this period in history (11th through 15th centuries), during the age of the Crusades, the first major clashes between the Arab Islamic world and the European cultures began.  It was the Third Crusade (1189–1192), where the fight for Jerusalem, sacred place of the people of scripts, of the rock, was at the spiritual and emotional heart for all Arab Christians, Copts, Jews, Muslims, and European Christians.  The battles that ensued during the Third Crusade also culminated into disasters of war, both Christian and Islamic armies were far from perfect in the eyes of a divine morality or God, as many lives were lost, with little gained, other than history of mortals made.

 Richard I, the Lionheart of noble pedigree, indeed, as the King of England (son of Henry II of England and Eleanor of Aquitaine), a shrewd military leader, who led by example in battles, and earned the moniker, the Lionheart, as no man could meet the vigor, strength, and swiftness of his sword in the heat of battle, only to find the silence of death waiting.  Also to his credit, Richard the Lionheart was above average strategic military thinker, and negotiator.  His decision-making was paramount, calm, and calculated, with the ability to size up the terrain, and the situation quickly.   Unlike Guy of Lusignan (c. 1150 – d. 1194) or Conrad of Montferrat (d. 1192), Richard the Lionheart used his wits, and ability to leverage military know-how with negotiations to create outcomes that his enemies had settle for compromise or choose more painful situation that would result in a greater loss of freedom, control, resolve, and at times unacceptable ruthlessness, beyond Abrahamic code.  It was of an extraordinary time, extraordinary place, where Saladin and Richard the Lionheart exhibited moments of  legendary leadership under inconceivable political, ethical, human, and mortal challenges, with unparalleled use of military power of the era.

 When Saladin captured Jerusalem (Siege of Jerusalem -1187), he followed Abrahamic tradition of kindness, and cleansed the city of Jerusalem with rose water not with blood of Christians, Copts or Jews.  Saladin’s act of cleansing the city with rose water was not only a powerful and epic Abrahamic metaphor but also perhaps a well-informed use of power.  Saladin often showed kindness to the populations he conquered regardless of the differences in faith.  During the Battle of Arsuf, Saladin observed Richard the Lionheart fall off his horse, and sent two of his horses to him so he could continue to fight as a noble or when Saladin heard that Richard the Lionheart sick with fever, he sent fruit and snow for water to drink.  It was not only an act out of admiration of Richard  the Lionheart as a leader but Saladin keenly understood the power and greatness of Abrahamic kindness as real and practical use of power; as such a power, will influence the future to come.

 In the end, Richard the Lionheart and Saladin both realized the sobering realities of the conflict; the battles were beginning to take a toll on their armies, and degrading their power, and control.  For Richard the Lionheart trouble was brewing back home in England, his brother was undermining his power as King of England, while the conquest of Jerusalem was becoming unsustainable reality.  For the first time, Saladin began to face the slipping away of the control and respect of his army.  In September of 1192, Richard the Lionheart and Saladin signed the Treaty of Jaffa, a three-year truce between the two armies.  The treaty guaranteed safe passage of Christians and Muslims through Palestine, stating that the Christians would hold the coast from Tyre to Jaffa, however, the rest of the lands of Afghanistan, Iraq, Syria, and the Levant region, including Jerusalem was left to Muslims’ control.  Despite Jerusalem’s stormy historical past with the ebb and flow of religious control of the city between the Abrahamic faiths, it is the legacy of Saladin and Richard the Lionheart where precedence was set (September 1192).  In that conflict can be negotiated and managed under Abrahamic code, and today the world recognizes the City of Jerusalem the rightful home to all three Abrahamic faiths, Christians, Jews, and Muslims.

Back to the Future to Syria:

 It is here in Syria and the Levant region, 725 years or more since the Crusades; we see age-old conflicts with improvident deaths, and destruction, along with a mutative twist of disasters of war.  In Syria, the war raging on is a civil war, complicated with a multitude of competing political-religious factions, and outside global interests.  To better, understand contemporaneous political and religious schism among the Arab, Persian, and Turkish states, one must turn the page back, to the historic and spatial context of five centuries of the Ottoman Empire, with the overlap with European culture, in which 19th century Orientalism became the narrow imperialistic European lens of all cultures Middle Eastern, East Indian, and Asian.  Edward Said’s notable critique of Orientalism as imaginary occidental view of Islamic culture resonated with many in the Islamic world long before Said’s book of the same title in 1978.

 After World War II, the Islamic world in the Middle East was fluid and search of Arab-Islamic identity, which led to the development of Arab-Islamic nationalism in the mid-twentieth century with the rise of Gamal Abdel Nasser (جمال عبد الناصر حسين) of Egypt.  Nasser became the architect of 1952 Revolution, and in 1954 assumed Egyptian leadership to bring a socialist style government to replace archaic Ottoman style monarchy as form of a modern governing institution.  Nasser nationalized the Suez Canal in 1956, which became to be victory-rallying point for Arab-nationalism in the region.  This began new threads of Arab socialist style governments led by Ba’ath Party such as in Iraq under Saddam Hussein, and in Syria under Bashar al-Assad.  Now in the twentieth first century, the complex threads of Arab Nationalists, Socialists, and Islamists have weaved a bloody tapestry in the Syrian civil war, where realities of death, torture, rape, cruelty, and inhumanity are beyond Abrahamic code and human comprehension.

Theater of the Syrian Civil War:

Total Casualties in Syria Based on Minimum Estimates: 
•    Estimates range from over 100,000 to 150,000 killed (Year 2014)
•    Over 9 Million humans displaced
•    Chemical weapons attacks on civilian areas
•    Barrel bombing civilian areas
•    Widespread use of rape as a weapon of war
•    Summary executions of prisoners, including children
•    Mutilation and display of corpses, including crucifixion
•    Torture, including of children

Bashar al-Assad Regime
Military forces fighting for President Bashar al-Assad are Syrian Armed Forces, Al-Quds Force, Basij Militia, National Defense Forces, and Hezbollah.   Assad’s core Syrian supporters are from the Alawite minority.
Ideology: Baathist, Secularist, Arab Nationalist
Supporting States: Russia, Iran
Goals: Preserving Assad’s regime

Syrian Armed Forces:
Commander: Fahd Jassem al-Freij
What: The National Armed forces of the state of Syria
Goal: Preserving Assad regime
Side: Regime
Component Groups: Infantry, Artillery, Tanks, Air Force
Estimated Strength: 220-280,000, Artillery, Air Power (Russian MiGs)
Strengths / Tactics: Dropping barrel-bombs on civilian areas

Additional Information: Syrian Armed Forces have complete domination of the air, and have perpetrating human rights abuses. The Syrian Air force mostly consist of Russian supplied MiGs.

Al-Quds Force and Basij Militia (Iran)
Commander: Qasem Soleimani
What: Iranian Revolutionary Guard’s Special Forces and Paramilitary Support Units
Goal: Iranian regional hegemony
Side: Assad Regime
Ideology: Shiite Islamist, Iranian Nationalist
Component Groups: Al-Quds Force, Basij Militias
Estimated Strength: Quds Force 15,000 total, Basij Militias unknown
Strengths / Tactics: Elite infantry force, superior training and military intel

Additional Information: The Al-Quds force is the elite unit of the Iranian Revolutionary Guard, set up after 1979 to safeguard the Islamic Republic. The Islamic State of Iran has sent IRG unit to secure Iranian interests in propping up Assad.  Aside from battlefield support, Iran also supplies weapons, intelligence, training and strategic advice. They do not merely serve as soldiers, but have input on a higher strategic level, to what extent are their strategic activity is unknown about the secretive force, but its strength is estimated at around 15,000 men in total, how many are in Syria is generally unknown. What is known the Basij supports them, fiercely loyal paramilitaries that serve under the Iranian Revolutionary Guard.

National Defense Forces (NDF) and Allied Paramilitary Groups:
Commanders: NDF unknown, Others: Mihrac Ural
What: Militia groups supporting Assad’s regime. NDF is the best known and largest.
Goal: Maintaining Assad’s regime
Side: Regime
Ideology: Shiites, Alawites, Baathists, Sunnis, Communists, Christians
Component Groups: NDF, Ba’ath Brigades (BB), TSR, Others
Estimated Strength: 100,000 for the NDF, BB 10,000
Strengths / Tactics: Brutal, guerrilla tactics

Additional Information:  The NDF militia groups are units that have been organized and formed into the National Defense Force in support of Assad.  These militias provide infantry to support the army. Due to fears over the loyalty of the army and the risk of defections, Assad typically sends regular units into battle alongside loyal militias such as Suqur al-Sahara (The Desert Falcons). An assortment of other militias and paramilitary organizations utilized as auxiliaries in the field.  Pro-Assad militias come from a variety of sects and political strands. The Baath Brigades, the military wing of the ruling Baath Party form Assad’s core power base.  Estimated strength of the National Defense Force stands at around 100,000 men.

Hezbollah:
Commander: Hassan Nasrallah
What: Lebanese Shi’ite terrorist group formed to fight Israel
Goal: Supporting Iran/Assad strategic alliance
Side: Regime, Iran
Ideology: Shiite Islamism
Component Groups: None
Estimated Strength: 20,000-30,000 (25% full-time active)
Strengths / Tactics: Well-trained, disciplined fighting force that turned the tide for the Regime at Qusayr and Yabroud battles

Additional Information:  Originally founded to fight Israel in Southern Lebanon, the Shiite militia force joined the conflict in 2013. Its name translates to “Party of God.” Assad, a long time backer of Hezbollah, and allows Iran to ship weapons to the terrorist group through Syria.  Hezbollah forces provided much needed reinforcements that have been instrumental in recent regime gains, in particular in recapturing the strategically important town of Qusayr in 2013, and recently Yabroud. It is widely regarded as being more powerful than the Lebanese army is. There are fears that Hezbollah’s involvement will drag heavily divided Lebanon into the war. The US State Department has classified the group as a foreign terrorist organization.

The Rebels:
Who:  Collection of unrelated militia forces fighting against President Bashar al-Assad’s regime, which consists of Sunni Islamists, secularist forces, Kurdish, and other militias.
Supporting States: Saudi Arabia, Qatar, Turkey, (to a lesser degree the USA and European countries)
Goals:  Removing Assad from power is their central goal.  The Sunni Islamist aim in the Syrian Civil War is the creation of an Islamic state, while Kurds aim for complete autonomy.

Islamic Front:
Commander: Ahmed Issa al-Sheik (from Suqour al-Sham)
What: A coalition of Islamist brigades
Goal: The removal of Assad and later creation of an Islamic State, Jihad
Side: Rebels, Islamists. Cooperates with Jabhat Al-Nusra
Ideology: Sunni Islamism
Component Groups: Ahrar as-Sham, Suquor al-Sham Brigades, The Tawhid Brigade, The Haq Brigade, The Ansar al-Sham Battalions, The Islam Army
Estimated Strength: 40,000 to 70,000 (March 5th)
Strengths / Tactics: Syria’s most powerful insurgent bloc, slightly more moderate Salafi Islamism than Nusra or ISIS

Additional Information:  “Syria’s most powerful insurgent bloc” formed as a merger between various Islamist factions that share the goal of establishing an Islamic State. A coalition of Islamist brigades has a semi-unified command. Tensions have existed between the Islamic Front and ISIS Groups were rankled by ISIS’s brutal application of Islamist principles and extreme violence. In particular, a series of high profile murders, especially the murder of a commander from Ahrar as-Sham and seizures of weapons depots by ISIS fighters provoked fellow Jihadis. The coalition fights variously against ISIS, Assad’s force and factions of the Free Syria Army (FSA). On and off it has cooperated with FSA banner coalitions such as the Syrian Revolutionary Front. Frequently, however, battalions have refused to fight their fellow Jihadis in ISIS, and have allowed FSA banner brigades such as those in the SRF to endure the most of the fighting.

Jabhat Al-Nusra:
Commander: Abu Mohammed al-Joulani
What: Al Qaeda’s official affiliate in the Syrian conflict
Goal: Global Islamic caliphate, Jihad
Side: Rebels, Islamists.
Ideology: Sunni Islamism
Component Groups: None
Estimated Strength: 15,000-20,000
Strengths / Tactics: Suicide bombings

Additional Information:  Al-Qaeda’s official affiliate in the Syrian Civil War, Nusra is one of the most effective and feared fighting forces in the war. They swear loyalty personally to al-Qaeda leader Sheik Zawahiri. They have (officially) prioritized defeating the regime over creating an Islamic state, leading to disagreements with ISIS, which does the opposite. It still maintains the long-term Islamist goal of establishing in Islamic Caliphate in the Levant. Their fighters are a combination of guerilla fighters from Iraq with experience fighting American soldiers and local Jihadists. Better funding and resources allowed Nusra to gain recruits at the expense of them cash-strapped Free Syria Army. ISIS and Nusra split in mid-2013 when Zawahiri called on ISIS to disband and they refused. They are allied with the Islamic Front and work together occasionally with FSA units such as the SRF.

Islamic State of Iraq and Syria (AKA: ISIS, ISIL, DAESH):
Commander: Abu Bakr al-Baghdadi
What: Terrorist group establishing state, formed from Islamic State of Iraq
Goal: An Islamic state in parts of Iraq and Syria, Global Islamic caliphate
Side: Rebels, Islamists
Ideology: Sunni Islamism
Component Groups: None
Estimated Strength: Reliable estimate unavailable
Strengths / Tactics: Brutality, implementation of sharia

Additional Information:  The most notorious of Syria’s many factions, this Sunni Islamist group seeks to establish an independent state in western Syria and northern Iraq.  Formed out of al-Qaeda in Iraq, called the Islamic State of Iraq, they initially entered the Syrian Civil War to support the Islamist cause there. Extreme violence and brutality in enforcing Sharia law have been the hallmarks of its presence. Recently they displayed the crucified bodies of their enemies in Raqqa.  Its Emir, Abu Bakr al-Baghdadi, had a personal dispute with the leader of Jabhat al-Nusra and with al-Qaeda head Sheik Zawahiri which resulted in the group being expelled from al-Qaeda. ISIS then stopped providing Iraqi oil revenues to Nusra.  It is currently engaged in fighting Kurdish militias, Nusra and other brigades flying FSA banners. ISIS is comprised mostly of foreigners and very few ethnic Syrians.  It has been accused of betraying the revolution to further its own ends and of collaborating with the regime.  ISIL (Daesh), propped up by a local ‘ansar’ network (helpers) that provides logistical and local support.

Free Syrian Army (FSA):
Commander: Various, officially Abdul-Ilah al-Bashir. Syrian Revolutionary Front (SRF)- Jamal Ma’aruf
What: Umbrella of broadly secularist rebel forces formed mainly from Syrian army deserters
Goal: End of the Assad regime, democratic state
Side: Rebels
Ideology: Broadly secularist, some Islamist elements/sympathies
Component Groups: Supreme Military Council, Syrian Revolutionary Front (SRF), Euphrates Islamic Liberation Front, others
Estimated Strength: Reliable estimate unavailable
Strengths / Tactics: Western backed official opposition, comparatively poor funding (under National Coalition of Syria).

Additional Information:  The oldest of the Syrian rebel factions, formed in the early days of the war primarily out of defectors from the Syrian army. They do not operate as a unified army rather they are a loose group of battalions and coalitions that fight under the broad banner of the FSA. They have suffered heavy losses both to regime forces and ISIS, whom they have been fighting but still remain a central component of the rebel forces. Their exact numbers are unknown. Fresh defections from the Syrian army have bolstered their ranks over the course of the war. Defections are estimated in the ‘tens of thousands.’  Some FSA brigades swear loyalty to the Supreme Military Council. They have received limited aid from the west. In response to the merger of the Islamic Front, a loosely western aligned coalition called the Syrian Revolutionary Front formed under the FSA banner, commanded by Jamal Ma’aruf. The Euphrates Islamic Liberation Front is another FSA banner coalition. On occasion these groups have fought the Islamic Front and Jabhat al-Nusra and have joined both against ISIS and the regime.

Independents:
Popular Protection Units (YPG) and Allies:
Commander: Sipan Hemo
What: Kurdish and allied militia groups in northeastern Syria, some Christian allies
Goal: Kurdish autonomy
Side: Against Islamists, aim for autonomy from Assad regime and Turkey
Ideology: Kurdish Nationalist, Christian Syriac Military Council (SMC)
Component Groups: YPG, Syriac Military Council
Estimated Strength: 40,000-50,000
Strengths / Tactics: Re-opening schools, driving out ISIS and Nusra

Additional Information:  Kurdish militia groups such as YPG have been fighting to protect their areas in the north of the country from both the ravages of war.  YPG recently joined by the Syriac Military Council, a Christian militia group that predominantly has focused on driving out ISIS, who enforced brutal Sharia law under their control, as well as kidnapping local leaders, and vandalizing Sufi mosques. They have also fought Nusra and other groups from the Islamic Front. YPG’s goals are to unifying and protecting Kurdistan that are affiliated with the Kurdish Democratic Union Party and the Kurdistan Workers Party (PKK) that operates in Turkey.   Yet, no calls have been made been for an independent Kurdish state.

Source and Credits: The Clarion Project  http://www.clarionproject.org/factsheet/whos-who-syrian-war

Oh Gabriel, Where Does Beauty Lie?

 No one knows how long or what the outcomes will be of the disasters of Syrian Civil War.  What the future holds for the Mid-East, and the Levant, will indeed be significant in many ways, either for better or worse, as we are now beginning observe the initial transformation.  Will there be a road to Damascus moment, is hard to say with the given the current stalemate in place.  As history is our guide, absolute authoritarian institutions or entities are not sustainable in the longer view, and even less so in the future, as the likes of Bashar al-Assad and Abu Bakr al-Baghdadi will come to pass, and perish, in time.  As for both Bashar al-Assad and Abu Bakr al-Baghdadi they have forgotten the values of Saladin, by cleansing their homelands with hate, retaliation, blood, and not with rose water, charity, and the Abrahamic codes of kindness, mercy, pity, grace, forgiveness, gratitude, refuge.

 Over four million Syrian, Iraqis, and Afghanistan refugees have clearly rejected ISIL (Daesh) and Sharia Law, with millions wanting to emigrate to the West where they have more freedoms, and economic opportunities for their families.  Gulf countries including Qatar, United Arab Emirates, Saudi Arabia, Kuwait, and Bahrain have offered zero resettlement places to Syrian refugees. Russia the state sponsor of the Assad regime have also offered zero resettlement places for Syrian refugees, and their humanitarian aid pales to their military assistance to Assad in the Syrian civil war, counted in innocent civilian deaths.  Although the United States has contributed more than $5.1 billion in Syrian humanitarian assistance, however, the United States under the Obama Administration could have provided the essential diplomatic and military leadership in the Syrian region much sooner.  Post Script: What the Assad regime, the Russians, Islamic State of Iran, and Hezbollah bring in brutality to the Syrian people, and where the past Obama’s administration lacked in courage in engagement, the Trump administration is equally morally inept in intellect and cultural understanding.

 The concepts of Sunni-Islamic states and Shia-Islamic states in the Middle East will not be going away as Egypt, Sudan, Afghanistan, Iran, Iraq, Lebanon, Libya, Pakistan, Qatar, Saudi Arabia, and Yemen, are all such examples.  As tragic as the Syrian Civil War is, there are opportunities to transform the Middle East region where Shiites, Sunni, Kurds, Copts, Christians, Jews, other religious ethnicities, can all thrive economically and work peacefully together or autonomously in the region but this will require the extraordinary political imagination, moral strength, courage, and intellect of many.  Oh Gabriel, where does beauty lie?

in sha’ allh – ان شاء الله

New Works on Paper 2016: Five Variations on the Disasters of War  © Richard Anthony Peña

Witches’ Sabbath:

 In the late seventeen hundreds, Goya began a series of paintings of witches as social-political protest and commentary against the Spanish Inquisition, the Church-State, Royalist, populist values, and belief in superstition. During the Spanish Inquisition, and in the rest of Europe, the Church-State was active in witch hunting, such as the Basque witch trials, and elsewhere in Europe. The Duchess of Osuna, Doña María Josefa Alonso-Pimentel y Téllez-Girón (b.1752 – d.1834) who was a Spanish aristocrat, known for her patronage of artists, writers, and scientists, commissioned the series of the witchcraft paintings in 1798.  The Duke and Duchess of Osuna were one of Goya’s most important patrons, and supporters of the Spanish Enlightenment.

 The superstition of witches and witchcraft has been around as long time since classical antiquity, where witchcraft historically, has been defined as necromancy to paganism to heresy throughout the ages, and along the way, many innocent women have suffered greatly, and died at hands of this terrible ignorance, and superstition. This terrible ignorance and ancient superstition of witchcraft in many ways became an archaic form of social control and persecution of women.  A more contemporaneous and universal form of this terrible ignorance, is the transformational state of misogyny.

 The fight against misogyny has been long and historic one, but the fight continues for womankind around the world; developed and developing countries.  Women in developing countries around the world face contemporary slavery and forced-labor, bondage from indebtedness, forced or servile marriage, human trafficking, commercial sexual exploitation, lack of access to education, and healthcare.  Many women and specifically girls under age 15 in developing countries face years after years of giving birth, a situation similar to constant cycle of animal husbandry, which put them at higher risks of maternity mortality.  Major complications account for 75% of all maternal deaths in developing countries; bleeding, infections, high blood pressure (pre-eclampsia and eclampsia), and complications from delivery.  One mother dies every 2 minutes in the world.  It is no surprise; the death of a mother has a devastating effect on her children, her family, and her community.  The implications of a mother’s death for girls are particularly great, often leading to a continued cycle of poverty and poor health.  Children without mothers are unlikely to receive proper nutrition, healthcare, and education.  Women are not only the caretakers of world, but the superglue of the human family, and from a world cultural perspective, women have played a role in shaping of modern culture’s refinement, from classical antiquity to twentieth first century.

Sappho, Cleopatra, Mary Magdalene, Boudicca, Hildegard of Bingen, Eleanor of Aquitaine, Joan of Arc, Mirabai, St Teresa of Avila, Elizabeth I, María Josefa Alonso-Pimentel y Téllez-Girón, Catherine the Great, Mary Wollstonecraft, Jane Austen, Margaret Fuller, Harriet Beecher Stowe, Elizabeth Cady Stanton, Queen Victoria, Florence Nightingale, Susan B. Anthony, Elizabeth Blackwell, Emily Dickinson, Emily Bronte, Marie Curie, Helena Rubinstein, Helen Keller, Eleanor Roosevelt, Anne Frank, Annie Besant, Simone de Beauvoir, Dorothy Hodgkin, Rosa Parks, Indira Gandhi, Golda Meir, Amelia Earhart, Raisa Gorbachev, Sophie Scholl, Wangari Maathai, Rosalind Franklin, Betty Williams, Mother Teresa, Shirley Anita St. Hill Chisholm, Jane Goodall, Shirin Ebadi,  Aung San Suu Kyi, Benazir Bhutto, Zaha Hadid, Malala Yousafza

 The underlying influences of the feminization of culture in predominant patriarchal societies around the world often become nuanced and understated, than acknowledged.  In some developing countries, where there is suppression of feminization as a form of social-political control, dormancy takes place but the feminine narrative is still very much alive and well with the spirit of life itself.  The struggle for global feminization faces many challenges for cultural, social-political, and economic parity in both developing and developed countries.  Only when patriarchal cultures transform to realize the value and importance of feminization in becoming highly developed, educated, technological advanced societies, is an imperative and futuristic necessity.

 Why is global feminization of culture important?  From the beginning of history and along with the unfolding of the human narrative, the loss of art, culture, and history, prevents us from truly understanding who we are as a species with X chromosome, it prevents us to view the present or even visualize the future with resolve.  The feminization of culture has elevated the arts, literature, science, as well as social-political changes, creating stable societies that embrace the ideals of beauty, truth, justice, liberty, and such ideals are major pillars of advanced societies with representative forms of democracies, whereas these ideals are well-known feminine personifications and representations of vision.

 As one day in the future may present the human race with a catastrophic crisis that will challenge the very existence of the humans; such as pandemic diseases, biological and radioactive contamination, asteroid impact, or other unforeseen threats to the stability of civilized humanity.  When more women around the world become educated in the arts, sciences, and social-political sciences, we increase our overall global intellectual capacity to innovate, create solutions, and solve problems or threats; increasing our odds and probabilities of having more Marie Curies of the world thinking of new ideas and solutions to not just global problems but to a means of a higher quality of life by lowering birth rates in over-populated countries, reducing maternity mortality, malnutrition, disease, poverty, and slavery. Yes, there is more to the global feminization than the morality and cultural impact of it all; there is a significant economic and productivity impact as well.  Should such a sea change fully occur, we will see a global economic expansion in the likes we have never measured before as the majority of women around the world become educated, monetarily independent, politically, and technologically free to contribute to the global economy, nevertheless, this time, all of humanity will benefit.

The Colossus:

 A painting traditionally attributed to Goya, which goes by several names such as El Gigante (The Giant), El Pánico (The Panic), La Tormenta (The Storm), and more popularly known as El Coloso (The Colossus).  Art experts estimate The Colossus was painted between the years of the Peninsular War (1808 – 1812).  The provenance of work begins with the estate inventory of Josefa Bayeu, Goya’s wife, where after her death, the painting awarded to Xavier Goya, their son in 1812; the markings of a white X and the number 18, painted by Goya as a way to inventory and distinguish paintings for his son’s inheritance.  It is not clear how Miguel Fernández Durán de Pinedo y Bizarrón became the owner of the painting, which inventoried in his estate, however, the painting was passed on to his great grandson.  The painting became the property of the estate of Pedro Fernández Durán and his mother, Paula Bernaldo de Quirós.  The painting entered the ownership of the Prado Museum in 1931 as part of the important legacy and collection of Don Pedro Fernández Durán estate.

 There are a number of interpretations of this painting called Colossus, however, the conventional knowledge and analysis references the Peninsular War and the Napoleonic occupation; describing the Colossus walking through the valley, with his legs obscured behind the mountainous horizon line with his fist elevated towards the sky in defiance, and eyes closed, blind like the Philistine giant Goliath.  In the shadow of the Colossus, lies the valley foreground, the villagers are in a panic, complete chaos breaks out, rape and violence left to human imagination.  The horses and the bulls run out and away from the center of the paintings, giving a sense of the fear, while the donkey remains calm and still.  Nigel Glendinning (1930-2013), noted authority on the history of Spanish art and, in particular, the works of Francisco de Goya, references Goya’s painting to a poem written by Juan Bautista Arriaza, called Pyrenean Prophecy, published in 1810.  The poem represents the Spanish people as a giant arising from the Pyrenees in order to oppose the Napoleonic invasion.  However, Goya created a number of works that were thematic of giants like the burnished aquatint etching with the same name, El Coloso (1814-1818) and the lithograph, Gran Coloso Dormido (1824-1828).

Very few artists and works of art that can transcend the values and analysis of their time, capable of a meditation of intrinsic and timeless values that haunt the past, present, and the future.  Goya’s Colossus is indeed one of those masterpieces, as there is another interpretation, which is a deep, dark, secret to behold, for the Colossus is real my friends, not real in physical presence but in spirit. The Colossus quietly sits at the edge of the horizon, brooding, pondering, and waiting to walk the lands, where the winds of his spirit stirs up chaos, anger, and senseless violence in the hearts of men.  The Colossus, the great provocateur, willingly employed, witnessed tens of thousands of battles and the great disasters of wars from antiquity to the present; Colossus encouraged and nurtured Homo sapiens to endure hardships of pride. If you still do not believe that Goya’s Colossus is real, then look again my friends, to Syria, Iraq, and the Levant, to see the Colossus’ handy work, where chemical weapons attacks, barrel bombing, use of rape as a weapon of war, executions, mutilation, display of corpses, crucifixion, torture, and killing of innocent civilians and children.  It is here in Syria, Iraq, Afghanistan, the Levant, Pakistan, Yemen, Africa, the world; the Colossus makes men intoxicated on their arrogance, hate, ignorance, and misogyny, where the Colossus knows no religions or God.

Sources:  BBC, Harvard Divinity School, Maternity Worldwide, Metropolitan Museum of Art, New York Times, Prado Museum, The Clarion Project, The Global Slavery Index, UN Refugee Agency, Walk Free Foundation, Wikipedia

#Goya “The sleep of reason produces monsters”

All Rights Reserved 2016 © Richard  Anthony  Peña

Posted in 2016 | Tagged , , , , , , , , , , , , , , , | Comments closed

Ralph Vaughan Williams: Gentle Genius of 20th Century British Classical Music


Northern France, World War I, 1917

Ralph Vaughan Williams finally woke up out of his early morning slumber after a restless night as it was the chill and the dampness of the place, along with the sounds of gunfire punctuating the French night that kept his body and soul at unease.  Vaughan Williams briskly stood up as a man in his forties, and embraced the morning, rubbed his eyes, and began to survey the French countryside while the dawn light began to spill over the horizon line defining the hills, meadows, and rolling pastures.  As Vaughan Williams looked out over the landscape, he thought how beautiful the natural world is, how truly divine.  Does not such beauty validate a divine love for us all?  His head began to fill up with thoughts of his father that he never knew, his mother Margaret, and the beautiful women in his social circle but mostly the music running through his head that he wanted to put down ink to paper.

If the early morning could not be any more beautiful, a chorus of the birds began singing songs filling the countryside.  As the daylight slowly became luminous, the morning light painted the pastoral landscape, and there high above the misty meadow below, a solitary lark hovers in the air, vacillating up and ascending high in the air, as to state to the entire sphere; this is a world of both wondrous and horrific beauty measured in fleeting cadence of time.  Such is the nature of the divine beauty, a heighten order of life itself one cannot possess, apprehend, or anticipate, as existence itself is never promised or with requital.  The lark suddenly darts up high in the blue sky once more, flies away into the distance, and disappears.

Lost in his thoughts about the lark, reminiscing about a poem he once read about a skylark, Vaughan Williams turned around to hear a voice coming from behind him, Sir, telegram, Sir telegram, he opens the envelope that is handed to him and reads each line twice, then whispers, George Butterworth.  Vaughan Williams then sits down putting his face into his hands trying to comprehend the death of his friend in both the Great War and life in music.  The powerful sounds of cannon fire start to mark the beginning of another day of the war, interrupting the peaceful French countryside, stealing away the divine and momentary beauty of the lark, of a time, never forgotten.

From Down Ampney to Leith Hill Place

Ralph Vaughan Williams was born on October 12, 1872 at Down Ampney, Gloucestershire.  Vaughan Williams was the third son of Reverend Arthur Vaughan Williams and Margaret Wedgewood.  On his father side the Vaughan Williams line were mostly lawyers and judges.  From his mother’s line, his forbearers were of the Darwin-Wedgewood family.  His mother was the niece of the renowned naturalist Charles Darwin and great granddaughter of Josiah Wedgewood, founder of Wedgewood Pottery.  The Darwin-Wedgewood family was wealthy, influential, and socially progressive as Josiah Wedgewood was a prominent abolitionist, and is remembered for creating, “Am I not a Man and a Brother?” anti-slavery medallion. Vaughan Williams’ father, AV Williams died when Vaughan Williams was about three in 1875, and the family moved from Down Ampney to his mother’s family Wedgewood home in Leith Hill Place.  There Vaughan Williams lived there for twenty years.

Life in Music

Vaughan Williams was educated at the Charterhouse school, and then went on to the study composition at the Royal College of Music with Sir Hubert Parry and Sir Charles Villiers Stanford.  In 1892, Vaughan Williams entered Trinity College, Cambridge to study church music and history with Charles Wood.  In 1899, he earned his Doctorate in music from Trinity College.  From 1899 to 1907, Vaughan Williams worked on many projects that will come to define his him in history of British music, editing the English Hymnals, and setting English folk songs from around the eastern counties north of London into classical form.  Vaughan Williams in his lifetime composed nine major symphonic works among notable and significant smaller works of music and choral.

Notable Works before 1907:

Serenade in A minor (1898)
Bucolic Suite (1900)
Willow Wood (1903)
In the Fen Country (1904)
Songs of Travel (1904)
Norfolk Rhapsodies (1905-1906)

Serenade in A minor (Romance Andantino-Appassionato): Written in 1898 and first performed in April 1901 at Bournemouth under the baton of Dan Godfrey.  By this time, Vaughan Williams had left the Royal College of Music and been married to his first wife, Adeline Fisher.  It was the Rev. W.J. Spooner, of Spoonerism fame, that married Ralph Vaughan Williams and Adeline Fisher.  They honeymooned in Berlin, where Vaughan Williams also studied with Max Bruch.  It was in Berlin where Vaughan Williams began writing Serenade in A minor.  Early works like Serenade in A minor exhibited his talent and sensibilities in creating an atmospheric symphonic landscapes with a harmonic balance of emotional and rationale spheres.   Serenade A minor, starts out with pulsing strings and searching winds and asking questions along the way, then recapitulate with the strings and horns with longing intensity and majestic tones.  Then a crescendo with violins in a high answer and soft rolling phrases with horns, drums and violins to the end.

Bucolic Suite:  The suite is also pastoral in nature. Bucolic is archaic English word for rural.  The work initially completed in November 1900, however, Vaughan Williams revised the work again, in 1901, which proved to be more of a refinement of the work.  The Bournemouth Orchestra under the baton of Dan Godfrey performed the Bucolic Suite on March 10, 1902, for the first time.  Bucolic Suite is sometimes paired up in performance with cantata published in 1951, Sons of Light. (mixed chorus and orchestra, text by his second wife, Ursula Vaughan William).

The Suite consists in four movements:
Allegro
Andante
Intermezzo (allegro)
Finale (Allegro)

Willow-Wood: The cantata Willow-Wood written in 1903 and the revision in its orchestral version first premiere in 1909.  The composer sets the cantata for baritone, wordless female chorus and orchestra of four sonnets, which Vaughan Williams turns into a tableau on love divided by Dante Gabriel Rossetti, House of Life.  The chorus mostly supplies the pre-Raphaelite color.  Vaughan Williams remained fond of the piece throughout his life, and tried to get the score republished just three years before his death, in which is evident of his regard for the work.

In the Fen Country:  An orchestral tone poem by Vaughan Williams, however, the composer described it as a symphonic impression.  Vaughan Williams had completed the first version of the work in April 1904, followed by a second, and third revisions, respectively in 1905 and 1907.  The first premiere was under the baton of Thomas Beecham in 1909.  Vaughan Williams’ musical evocation of the English countryside, portraying eastern England, a region sometimes referred as the Fens, includes parts of Cambridgeshire, Suffolk, Norfolk, and Lincolnshire.  An eloquent mediation and building up emotions with the subtlety of the violins, winds, and defining horns as like waiting for a thunderstorm to arrive with growing anticipation of the summer storm.  Reaching the intensity of the musical storm and release, the rain comes sweeping across the fields and pastures, soaking the earth and all who dwell in it.  The storm passes into the distance and strands of sunlight start to break through the clouds. Highlighted are the top of the trees with a golden crown of light contrasted with cyan and blue tones of the dark clouds canvassing the sky.  The lower tones contemplate the same questions, phrasing and re-phrasing, finding ease, with this good earth of England.  Then recapitulation back to the melancholy tones of passing of time and a soft exit from the Fen country with a long turning note of the violin into silence.

Songs of Travel: Song cycles composed by Vaughan Williams based on poems by Robert Louis Stevenson. Written for baritone voice but was originally written for a piano and voice.  All song cycles also have a second key version for tenor.  Vaughan Williams orchestrated, The Vagabond, Roadside Fires, and Bright is the Ring of Words, while Roy Douglas who was Vaughan Williams’ music assistant, finished the other six song cycles with the same orchestration and is a co-orchestrator to the work of Songs of Travel.  Songs of Travel, written between 1901 and 1904 and these song cycles are Vaughan Williams’ first major introductions into song writing and quintessential British version of the wayfarer.

The Eight Song Cycles of Songs of Travel:
1. The Vagabond
2. Let Beauty Awake
3. The Roadside Fire
4. Youth and Love
5. In Dreams
6. The Infinite Shining Heavens
7. Whither Must I Wander
8. Bright is the Ring of Words

Norfolk Rhapsodies: A series of three symphonic folk songs developed by Vaughan Williams around 1905-1906.  Specifically the collections of folk songs are from Norfolk County, King’s Lynn fishing port.  Norfolk Rhapsody No. 1 in E minor is the only Rhapsody that survived in its entirety and which Vaughan Williams revised in 1914.   The second Rhapsody is incomplete and is in a fragmented form but reconstructed by Stephen Hoggers.   The third Rhapsody is lost completely since 1920.  Vaughan Williams intended the three Rhapsodies to form a symphonic folk song; the first Rhapsody as the first movement, the second Rhapsody combing the second and third movements along with a scherzo.  The third Rhapsody was to form the final, a quick march and trio.  Norfolk Rhapsody No. 1 in E minor is indeed the essence of Englishness and life on the sea.

Norfolk Rhapsody No. 1 in E minor
Norfolk Rhapsody No. 2 in D minor
Norfolk Rhapsody No. 3

In 1907, Vaughan Williams arranged to study in Paris with Maurice Ravel. It was writer and critic Michel de Calvocoressi who convinced Vaughan Williams to study with Ravel.  The three months spent studying with Ravel influenced Vaughan Williams’ compositions and use of color.

“I learned much from him.  For example, that the heavy contrapuntal Teutonic manner was not necessary. ‘Complexe mais pas compliqué'(Complex but not complicated) was his motto.  He showed me how to orchestrate in points of colour rather than in lines.”

“His own music was ‘tout à fait simple, rien que Mozart’ (quite simple, nothing than Mozart). He was against development for its own sake – one should only develop for the sake of arriving at something better.”

Some observers of the time thought Vaughan Williams’ music had more depth and developed a distinct signature of music after 1907. Vaughan Williams produced six powerful symphonic works during this time from 1907 to 1914.

Notable Works 1907-1914:

On Wenlock Edge: (1909)
Aristophanic Suite: The Wasps (1909)
Sea Symphony (1910)
Fantasia on a Theme by Thomas Tallis (1910)
Five Mystical Songs (1911)
London Symphony (1913)

On Wenlock Edge: The first symphonic work Vaughan Williams developed after his Ravel experience.  A song cycle composed of six poems by A. E. Housman, ‘A Shropshire Lad’ (1896).  Although the works is for voice, violin, and piano the composition reflect his Paris experience with the use simplicity and points of color.

Taken from A Shropshire Lad:
 XXXI “On Wenlock Edge”
 XXXII “From far, from eve and morning”
 XXVII “Is my team ploughing?”
 XVIII “Oh, when I was in love with you”
 XXI “Bredon Hill” 
 L “Clun” 

Aristophanic Suite: The Wasps:  In 1908, the Cambridge Greek Play Committee invited Vaughan Williams, while at Trinity College as an undergraduate to create incidental score for the play, “The Wasps”.  His mentors at Cambridge, Hubert Parry and Charles Villiers Stanford supported Vaughan Williams’ nomination and both taught Vaughan Williams his craft of scoring and composition.  The play “The Wasps” authored by the ancient Greek playwright of Athens, Aristophanes, and the Old Comedy play satirizes the love of litigation by ancient Athenians.  The Wasps, considered Vaughan Williams’ foray into incidental but it is the Wasp Overture that is widely known and the most popular out of the suite today.  The March Past of the Kitchen Utensils is also quite a gem out of the suite as well but lesser known.

Sea Symphony: Considered Vaughan William’ first major symphony, sometimes referred as Symphony No.1.  Vaughan Williams worked intermittently on the chorus and orchestration between 1903 and 1909.  The Sea Symphony began a new era of symphonic and choral music.  The Sea Symphony was one of the first symphonies in which a choir is an integral part of the musical texture and words of the choir come from Walt Whitman’, Leaves of Grass.  This was the first time British audiences heard Whitman’ poetry sung or alone exposed to Walt Whitman’ poetry.  First performed in 1910 at the Leeds Festival on his 38th birthday and received critical acclaim in Britain.   Hugh Cobbe, editor of Ralph Vaughan Williams’ letters stated, “He was already 38 that is a late composer, was not Mozart already dead at that point.  He was late developer and he kept on developing to the end of his life.”  Vaughan Williams’ final and last symphony was composed from 1956–1958, and completed when he was 85 years of age.  During the period (1903-1909), an informal narrative or story went around about his struggle with creating the work of the Sea Symphony; Vaughan Williams went to a disserted beach near Yorkshire, Robin hood Bay to take a swim in the sea and found himself in a dangerous position, the sea waves were rougher than he thought, and he could not get back onto the rocks for a prolonged period.  Vaughan Williams struggled to a point where he was exhausted and was about to give in to drowning in the sea, when a fluke of nature happened, a large wave lifted him out of the sea up onto the rocks.  Vaughan Williams went on to creating eight more symphonic works to the end of his life.

Sea Symphony Structure:

Movement 1 – Fast introductory – “A Song for All Seas, All Ships”
(baritone, soprano, and chorus)

Movement 2 – Slow – “On the Beach at Night Alone”
(baritone and chorus)

Movement 3 – Scherzo – The Waves –  “After the Sea-ship”

Movement 4 – Finale – The Explorers – “Passage to India”  
(baritone, soprano, semi-chorus, and chorus)

The first movement lasts roughly twenty minutes; the inner movements approximately eleven and eight minutes, and the finale lasts roughly thirty minutes.

Fantasia on a Theme by Thomas Tallis:  A String Orchestra based on Thomas Tallis, one of England’s greatest composers in British history of music.  Vaughan Williams’ Tallis Fantasia captures the spirit of the period music but still carries Vaughan Williams harmonic signatures that uniquely are Ralph Vaughan Williams.  Fantasia on a Theme by Thomas Tallis performed and conducted for the first by Vaughan Williams in September of 1910 in Gloucester Cathedral for the Three Choirs Festival.  The composition proved to be a major success for Vaughan Williams.  The Tallis Fantasia proved to be a game changer as well that year with its cathedral sound, which left some composers attending the concert that night wandering the streets of London all night reflecting what they heard at the Gloucester Cathedral concert, with a work of astonishing originality.  Tallis Fantasia song is one the most spiritual interpretation without a religious context in the early half of the twentieth century.   The composer revised Tallis Fantasia score in 1913 and again 1919.

Five Mystical Songs:  Written between 1906 and 1911 by Vaughan Williams, and like many of Vaughan Williams’ works, poems or literary texts are set to music.   This work sets four poems by George Herbert (1593–1633), a seventeenth-century Welsh-born English poet and Anglican priest.  First performed on 14 September 1911, at the Three Choirs Festival in Worcester, with Vaughan Williams conducting, and considered a critical success.  The work written for a baritone soloist, with several choices for accompaniment:

• Piano only.
• Piano and string quintet.
• TTBB (Tenor 1, Tenor 2, Bass 1 (Baritone), Bass 2) chorus, a cappella.
• Orchestra with optional SATB (soprano, alto, tenor, bass) chorus. This was the choice used at the premiere.

The first four song cycles, Easter, I Got Me Flowers, Love Bade me welcome, and The Call, are sober, introspective, meditations on life with the same intrinsic spirituality as the original text.  A baritone soloist like Sir Thomas Allen can turn notes, hence, providing consistent and strong foundation and structure throughout the suite.  Vaughan Williams masterfully integrates the voices of the instrumentation, soloist, and chorus providing the organic unity of the suite.  Antiphon is perhaps the most different out the five song cycles, cheerful and upbeat anthem; “Let all the world in every corner sing”.

1. Easter – from Herbert’s Easter
Rise heart; thy Lord is risen. Sing his praise without delayes, Who takes thee by the hand, that thou likewise with him may’st rise; That, as his death calcined thee to dust, his life may make thee gold, and much more, just.  Awake, my lute, and struggle for thy part with all thy art.  The crosse taught all wood to resound his name, who bore the same. His stretched sinews taught all strings, what key is the best to celebrate this most high day. Consort both heart and lute, and twist a song pleasant and long; Or since all musick is but three parts vied and multiplied.  O let thy blessed Spirit bear a part,and make up our defects with his sweet art.

2. I Got Me Flowers – from the second half of Easter
I got me flowers to strew thy way; I got me boughs off many a tree: But thou wast up by break of day, and brought’st thy sweets along with thee.  The Sunne arising in the East. Though he give light, and th’East perfume; If they should offer to contest With thy arising, they presume.  Can there be any day but this,though many sunnes to shine endeavour?  We count three hundred, but we misse: There is but one, and that one ever.

3. Love Bade Me Welcome – from Love
Love bade me welcome: yet my soul drew back. Guiltie of dust and sinne. But quick-ey’d Love, observing me grow slack From my first entrance in, drew nearer to me, sweetly questioning if I lack’d anything. A guest, I answer’d, worthy to be here: Love said, You shall be he. I the unkinde, ungrateful? Ah, my deare, I cannot look on thee. Love took my hand, and smiling did reply, Who made the eyes but I? Truth Lord, but I have marr’d them: let my shame Go where it doth deserve. And know you not, sayes Love, who bore the blame?  My deare, then I will serve. You must sit down, sayes Love, and taste my meat: So I did sit and eat.

4. The Call – from The Call
Come, my Way, my Truth, my Life: Such a Way, as gives us breath: Such a Truth, as ends all strife: Such a Life, as killeth death. Come, my Light, my Feast, my Strength: Such a Light, as shows a feast: Such a Feast, as mends in length: Such a Strength, as makes his guest.  Come, my Joy, my Love, my Heart: Such a Joy, as none can move: Such a Love, as none can part: Such a Heart, as joyes in love.

5. Antiphon – from Antiphon
Let all the world in ev’ry corner sing: My God and King. The heavens are not too high, His praise may thither flie; The earth is not too low, His praises there may grow. Let all the world in ev’ry corner sing: My God and King. The Church with psalms must shout, no doore can keep them out; But above all, the heart must bear the longest part. Let all the world in ev’ry corner sing: My God and King.

London Symphony: This symphony sometimes referred to as the Symphony No. 2 but was not designated as so. The symphony was composed from 1912 to 1913.  Vaughan Williams dedicated to his friend and fellow composer George Butterworth (1885–1916), killed during the Great World War I.

George Butterworth had first encouraged Vaughan Williams to write a purely orchestral symphony:

“We were talking together one day when he said in his gruff, abrupt manner: ‘You know, you ought to write a symphony’. I answered… that I have never written a symphony and never intended to… I suppose Butterworth’ words stung me and, anyhow, I looked  at some sketches I had made for… a symphonic poem about London and decided to throw it into symphonic form… From that moment, the idea of a symphony dominated my mind. I showed the sketches to George bit by bit as they were finished, and it was then that I realized that he possessed in common with very few composers a wonderful power of criticism of other men’s work and insight into their ideas and motives. I can never feel too grateful to him for all he did for me over this work and his help did not stop short at criticism.”

First performed in 1914, the four-movement symphony was lost shortly after the first performance and reconstructed by Geoffrey Toye, George Butterworth and the critic E. J. Dent.  From the program notes from a concert in 1920, Vaughan Williams said that while the title may suggest a programmatic piece but intended as absolute music and suggested that Symphony by a Londoner might be a better title.  Vaughan Williams did allow conductor Albert Coates to provide elaborate descriptions for the 1920 performance.  Vaughan Williams continued to make changes to London Symphony, between 1914 and 1933 accumulating approximately 3,724 changes to the score with the final version more than twenty minutes shorter than the original.

London Symphony – Four Movements:
1. Lento – Allegro risoluto
2. Lento
3. Scherzo (Nocturne)
4. Finale – Andante con moto – Maestoso alla marcia – Allegro – Lento – Epilogue

Notable Works of 20s and 30s

The Lark Ascending (1914-1921)
Pastoral Symphony (1922)
Mass in G minor (1922)
Hugh the Drover (Opera) (1924)
Job – A Masque for Dancing (1931)
Piano Concerto (1931)
Symphony in F minor No.4 (1934)
Five Tudor Portraits (1935)

The Lark Ascending: In 1914, Vaughan Williams was inspired write a composition and musical work based on a poem by the English poet George Meredith about the song of the skylark, The Lark Ascending.  Originally, Vaughan Williams composed The Lark Ascending in 1914 for violin and piano.  Vaughan Williams continued to work the composition until the first public performance in 1920.  Later the composer re-scored it for solo violin and orchestra with the help of violinist Marie Hall, which premiered in 1921.  The Lark Ascending is perhaps the quintessential transcendental symphonic work of the twentieth century.  A symphonic meditation upon life itself through the motif of the lark (violin) as the personification of the nature world, human spirit, and gentleness, in contrast to harsh realities of the human narrative.  The lark takes us on a musical journey where we learn of what the love of life means with all of its vicissitudes but through this journey, we experience evocation, simplicity, and of beauty of the natural world as the divine gateway.

Pastoral Symphony: Also known as Symphony No. 3, but published as A Pastoral Symphony in 1922, and numbered later. The inspiration to write this symphony came during World War I, Vaughan Williams once commented, after hearing a bugler practicing and accidentally playing an interval of a seventh instead of an octave,” this said to inspired the trumpet cadenza in the second movement. The Pastoral Symphony gained the reputation of being a subtly beautiful elegy for the dead of World War I and a meditation with an evocative spirit.  The Pastoral Symphony first performed in London on January 16, 1922, under the baton of Adrian Boult.  Vaughan Williams emphasized, however, that the work is “not really Lambkins frisking at all as most people take for granted”.   The frame of reference for Vaughan Williams was the fields of France during World War I, where Vaughan Williams served in the Royal Army Medical Corp.

The work consists in four movements:
1. Molto moderato
2. Lento moderato – Moderato maestoso
3. Moderato pesante
4. Lento

Mass in G minor:  A choral work written in 1921; a distinctly English style mass.  Tthe City of Birmingham Choir performed the Mass in G minor on December 6, 1922.  Although the first performance was in a concert, however, the composer intended the Mass in G minor to be performed in a liturgical setting.  Ralph Vaughan Williams dedicated the work to his good friend, Gustav Holst.Gustav Holst and the Whitsuntide Singers.

The work consists of five movements:
1. Kyrie
2. Gloria in excelsis
3. Credo
4. Sanctus Osanna I – Benedictus – Osanna II
5. Agnus Dei

Hugh the Drover:  An opera in two acts based on an original English libretto by Harold Child. Vaughan Williams worked on the operatic work for a number of years; before and after World War I.  The opera’s first performance was on July 4, 1924 at the Royal College of Music, London and the “professional premiere” was at His Majesty’s Theatre on July 14, 1924. The opera’s first U.S. performance took place on February 21, 1928.  Also the opera was performed by the professional Canadian Opera Company in Toronto in November 1929, at the Royal Alexandra Theatre in Toronto, which included a live radio broadcast from the Royal York Hotel on November 13, 1929.  Vaughan Williams continued to revise the libretto and the opera over the remainder of his life. The final version was performed in 1956 and published in 1959.

Roles:
Mary (soprano)
Aunt Jane (mezzo-soprano)
Hugh the drover (tenor)
John the butcher (baritone)
Sergeant (baritone)
Constable (bass)
A cheap-jack (tenor)
Shellfish seller (bass)
Primrose seller (soprano)
Showman (baritone)
Ballad seller (tenor)
Susan (soprano)
Nancy (mezzo-soprano)
William (tenor)
Robert (baritone)
Turnkey (tenor)
Fool (tenor)
Innkeeper (baritone)

Time and Place: Year 1812 – The Cotswolds

Act 1

The outskirts of the town

A fair is taking place; the people of the town have turned out; vendors hawk their wares. A showman presents an effigy of Napoleon Bonaparte and rouses the crowd to a fever-pitch of patriotic zeal.

Mary, the daughter of the local constable, appears with her aunt. Her father wants to marry her to John the butcher, a crass, overbearing man whom she does not love. When John roughly takes Mary’s arm to walk through the fairgrounds with her, she resists. He threatens her in turn, but when a troop of morris men passes through, the crowd follows along and John is pulled along with them, leaving Mary alone with her aunt.

As Mary sings of her dreams of freedom, a young man appears and tells her of his life on the open road. He is Hugh the Drover, a driver of animals, who makes his living by providing horses for the army. Mary is fascinated by his words, and Hugh tells her that he was fated to love her. The two declare their love for each other and embrace.

The crowd returns and the showman organizes a prizefight, inviting all the men to challenge John the butcher. Hugh agrees to box, but only if the prize is Mary herself. He beats John in the match, only to have John spitefully accuse him of being a French spy. The crowd turns against Hugh and he is led off to the stocks.

Act 2

The town square, early morning

A troop of soldiers has been sent for to take Hugh into custody. Meanwhile, he remains a prisoner in the stocks.

Mary stealthily comes to rescue him, having stolen the key to the stocks from her father. She frees him, but before they can escape, they hear John and his comrades approaching. Each refuses to leave without the other, and they both get into the stocks (which are large enough to hold two),draping Hugh’s cloak over their bodies. When they are exposed, Mary’s father disowns her and John refuses to marry her.

The soldiers arrive, and their sergeant recognizes Hugh as an old friend who once saved his life. Instead of arresting him, they acclaim him as a loyal Briton – but take John the butcher for a soldier and march off with him.

Hugh and Mary reaffirm their love. Hugh asks Mary to join him, and she at first is hesitant, as is Aunt Jane to lose her. However, Mary finally says ‘yes’, and she and Hugh bid the town farewell to begin their life together.

Job: A Masque for Dancing:  Music for a ballet.  The premiere in concert form transpired in October 1930 at the Norfolk and Norwich Festival, under the baton of Vaughan Williams.  The world premiere performed on July 5, 1931 at the Cambridge Theatre in London’s West End theatre district.  The work called “masque” because Vaughan Williams disliked the word “ballet”.  Vaughan Williams began writing the score after the idea for the ballet was initially proposed to the Russian ballet impresario Sergei Diaghilev, who rejected it.  At first Vaughan Williams had written for a larger orchestra which could be accommodated in a conventional theatre pit and when the ballet was produced, then the music was orchestrated for a small orchestra by Constant Lambert.  The ballet was also performed by the Vic-Wells Ballet, which later became known as the renowned Sadler’s Wells Ballet.  The original concept and libretto for the ballet was proposed by the scholar Geoffrey Keynes, with choreography by Ninette de Valois, music by Ralph Vaughan Williams, orchestrations by Constant Lambert and designs by Gwendolen Raverat.  The ballet is based on the Book of Job from the Hebrew Bible and was inspired by the illustrated edition by William Blake, published in 1826.  Geoffrey Keynes who first proposed the idea for the ballet was a respected authority on the work of William Blake.  Vaughan Williams dedicated the score to the conductor Adrian Boult in 1934. Boult made four commercial recordings of the work, including the first recording in 1946 with the BBC Symphony Orchestra and his fourth and final recording was taped in 1970 with the London Symphony Orchestra.

The full orchestral version is scored for three flutes (third doubling on piccolo and bass flute), two oboes, cor anglais, two clarinets (in Bb), alto saxophone, bass clarinet (doubling on third clarinet in Bb), two bassoons, contrabassoon, four horns (in F), three trumpets (in Bb), three trombones, tuba, timpani, triangle, side drum, cymbals, bass drum, xylophone, glockenspiel, tam tam, organ, two harp, and strings.

The Cast
Donald Britton
John Cranko
Leslie Edwards
Julia Farron
John Field
Alexander Grant
Robert Helpmann
Rowena Jackson
Gillian Lynne
Nadia Nerina
Michael Somes

The ballet includes 9 scenes, based upon the sequence of Blake’s illustrations and each including quotations from the Bible.

Scene I: “Saraband of the Sons of God” (“Hast thou considered my servant Job?”)– Introduction
– Pastoral Dance
– Satan’s Appeal to God
– Saraband of the Sons of God

Scene II: “Satan’s Dance of Triumph” (“So Satan went forth from the presence of the Lord.”)
– Satan’s Dance

Scene III: “Minuet of the Sons of Job and Their Wives” (“There came a great wind and smote the four corners of the house and it fell upon the young men and they are dead.”)
– Minuet of the Sons and Daughters of Job

Scene IV: “Job’s Dream” (“In thoughts from the visions of the night….fear came upon me and trembling.”)
– Job’s Dream
– Dance of Plague, Pestilence, Famine and Battle

Scene V: “Dance of the Three Messengers” (“There came a messenger.”)
– Dance of the Messengers

Scene VI: “Dance of Job’s Comforters” (“Behold happy is the man whom God correcteth.”)
– Dance of Job’s Comforters
– Job’s Curse
– A Vision of Satan

Scene VII: “Elihu’s Dance of Youth and Beauty” (“Ye are old and I am very young.”)
– Elihu’s Dance of Youth and Beauty
– Pavane of the Heavenly Host

Scene VIII: “Pavane of the Sons of the Morning” (“All the Sons of God shouted for joy.”)
– Galliard of the Sons of the Morning
– Altar Dance and Heavenly Pavane

Scene IX: “Epilogue” (“So the Lord blessed the latter end of Job more than his beginning.”)

Piano Concerto in C:  Written in 1926, movements 1 & 2 and movement 3 between 1930-31 . During the years between 1926 and 1931, Vaughan Williams completed, Job: A Masque for Dancing, and began work on his Fourth Symphony.  The Piano Concerto in C shares some thematic characteristics with these works in likeness in their drama and turbulence.  The work was premiered on February 1, 1933 by Harriet Cohen, with the BBC Symphony Orchestra under the baton of by Sir Adrian Boult.  The concerto was not well received at first, being considered unrewarding by some soloists of the day. The Concerto does provides ample opportunity for virtuosity in all movements, but Vaughan Williams treatment of the piano was percussion like, as did Béla Bartók and Paul Hindemith during this period, with the texture at times heavy.  Vaughan Williams took the advice of colleagues and reworked the piece into a Concerto for Two Pianos and Orchestra in 1946, by adding more texture to the piano parts with the assistance of Joseph Cooper.

Concerto Structure:
1. Toccata: Allegro moderato – Largamente – Cadenza
2. Romanza: Lento
3. Fuga chromatica con Finale alla Tedesca

Symphony No. 4 in F minor:  First performed on April 10, 1935 by the BBC Symphony Orchestra and under the baton of Adrian Boult.  The United States premiere was given on December 19, 1935 with Conductor Artur Rodziński and the Cleveland Orchestra.  Its first recording, made two years later, featured Vaughan Williams, himself conducting the same orchestra in what came to be his only commercial recording of any of his symphonies.  Unlike Vaughan Williams’ first three symphonies, the fourth was not given a title, the composer stating, that it was to be understood as pure music, without any incidental or external inspiration.  The fourth symphony displays a more severity of tone.  The composer himself once observed of it, “I’m not at all sure that I like it myself now.  All I know is that it’s what I wanted to do at the time.” The British composer Sir William Walton admired the work greatly, speaking of it as “the greatest symphony since Beethoven”.  Only two symphonies of Vaughan Williams end loudly, No.4 and No.8..

The work consists in four movements:
1. Allegro
2. Andante moderato
3. Scherzo : allegro molto
4. Finale con epilogo fugato : allegro molto

Five Tudor Portraits: Written in 1935 at the suggestion of composer Edward Elgar to explore the poetry of Tudor Poet John Skelton, (c. 1460-1529) in which Vaughan Williams enjoyed reading the short erratic rhyming verses, possibly descending from Medieval Latin rhyming prose.  The language is colorful and sometimes crass.  The five Skelton poems set in the work are not connected in any way.  Written between 1490 and 1522 and the length of each sketch varies with “Elinor Rumming” (15 minutes) and “Jane Scroop” (20 minutes) each taking more time than the other three movements combined.  Vaughan Williams takes as much time as necessary to flesh out each character:

Five Tudor Portraits:
Elinor Rumming—innkeeper and ugliest woman in the world
Pretty Bess — the object of the singer’s desire
John Jayberd — a dead priest, beloved by no one
Jane Scroop — a child whose pet sparrow was killed by a vicious cat
Jolly Rutterkin — a cheerful, drunken neighbor

Notable Works between 1936 -1958

Dona Nobis Pacem (1936)
Riders to the Storm (1936)
Serenade to Music (1938)
Five Variants of Dives and Lazarus (1939)
Symphony No 5 in D (1943)
Symphony No 6 in E minor (1948)
The Pilgrim’s Progress (1951)
Symphony No 7 Sinfonia Antartica (1953)
‘Hodie’ This Day (1954)
Symphony No 8 in D minor (1955)
Symphony No, 9 in E minor (1958)

Dona Nobis Pacem: English translation from Latin is, Grant us Peace, and is a cantata written by Vaughan Williams in 1936, a commissioned work to mark the centenary of the Huddersfield Choral Society.  First performed on October 2, 1936, and considered a plea for peace referring the early twentieth century, first marked by World War I, and later followed by World War II.   Vaughan Williams inserted three poem verses; lines from a Walt Whitman poem, verse from the Book of Jeremiah, and political speech of John Bright formed the vocal lines for the chorus.  Originally scored for large orchestra, and featuring both soprano and baritone soloists.

Riders to the Storm:  A short one-act opera by Vaughan Williams, based on the play with the same name by John Millington Synge.  Vaughan Williams completed the score in 1927, but it did not premiere until December 1, 1937, at the Royal College of Music, London.  The opera remained largely unknown until it entered the repertoire of Sadler’s Wells in 1953.  Vaughan Williams essentially keeps Synge’ text in place with only minor changes.  The vocal score published in 1936; however, the full orchestral score was published in 1973.

Serenade to Music: A signature Vaughan Williams choral work with orchestration written in 1938.  Vaughan Williams once said, But in the next world I shan’t be doing music, with all the striving and disappointments.  I shall be being it.”  Serenade to Music is the quintessential Vaughan Williams style with original orchestration, and choral singing poetic lines, calling out vocal lines of Shakespeare:  “How many things by season season’d are.  To their right praise and true perfection!  Peace, ho!  The moon sleeps with Endymion and would not be awak’d.  Soft stillness and the night, become the touches of sweet harmony.”

Five Variants of Dives and Lazarus: A work composed for harp and string orchestra and commission from the British Council to be played at the 1939 World’s Fair in New York City. The premiere performance was performed by the New York Philharmonic at Carnegie Hall on June 10, 1939, under the baton of by Sir Adrian Boult.  The work is based on the folk tune “Dives and Lazarus” and arranged by Vaughan Williams as a hymn tune “Kingsfold,” appearing as “O Sing a Song of Bethlehem,” in The English Hymnal as “I Heard the Voice of Jesus say,” (no. 574 in the original 1906 edition).

Five Variants of Dives and Lazarus structure:
 Introduction and Theme: Adagio, B modal minor
 Variant I: B modal minor
 Variant II: Allegro moderato, B modal minor
 Variant III: D modal minor
 Variant IV: L’istesso tempo
 Variant V: Adagio, B modal minor

Symphony No 5 in D: Return to the more romantic style of the earlier Pastoral Symphony written between 1938 and 1943.  Symphony No 5 in D, stemmed from then unfinished operatic work, The Pilgrim’s Progress, an opera or morality play in which Vaughan Williams like to refer it to, while discussing the work.  Vaughan Williams struggled with his fifth, and at one point doubted the new work, but later changed his mind after hearing orchestrated.   The work was dedicated without permission to the Finnish composer Jean Sibelius at the time of the first publishing.  When permission was gained, Sibelius wrote: : “I heard Dr. Ralph Vaughan Williams’ new Symphony in Stockholm under the excellent leadership of Malcolm Sargent…This Symphony is a marvelous work … the dedication made me feel proud and grateful…I wonder if Dr. Williams has any idea of the pleasure he has given me?   The composition, scored for two flutes (one doubling piccolo), oboe, cor anglais, two clarinets, two bassoons, two French horns, two trumpets, three trombones, timpani and strings. It is structured in four-movement form:  Preludio, Scherzo, Romanza, and Passacalia.

Symphony No 6 in E minor: Vaughan Williams composed this work in 1946–47, during and after right after World War II.  BBC Symphony Orchestra first performed the symphony under the baton of conductor Sir Adrian Boult on April 21, 1948.  Symphony No 6 in E minor, within a year span gained in popularity with having over 100 performances, which also included the US Premiere by the Boston Symphony Orchestra under Serge Koussevitzky on August 7, 1948.  The first New York performance was the following January with the New York Philharmonic under Leopold Stokowski conducting and immediately recorded it, declaring, “this is music that will take its place with the greatest creations of the masters.”  However, Vaughan Williams had struggled and had mixed feelings about the quality of this work and threatened several times to tear up the draft throughout the development of the work.  The program note for the first performance reflected and suggested his discord about the work.

The Pilgrim’s Progress: An opera by Ralph Vaughan Williams, based on John Bunyan’ allegory, The Pilgrim’s Progress.  Vaughan Williams described the work as a ‘Morality Play’ rather than an opera and with all intent to perform on stage. Vaughan Williams himself prepared the libretto, with inserts from the Bible and text from Ursula Wood, his second wife.  Vaughan Williams also made changes to the original story including altering the name of the central character from ‘Christian’ to ‘Pilgrim’, so to bring universality of the spiritual message.  The opera contains 41 individual singing roles. The first performance was at the Royal Opera House, Covent Garden on April 26, 1951 with Leonard Hancock as the conductor, whom Vaughan Williams had personally chosen to conduct the premiere.  The opera consists of Prologue, Act 1, Act 2, Act 3, Act 4, Entr’acte and Epilogue.

Symphony No 7 Sinfonia Antartica: Vaughan Williams composed the music for the film, Scott of the Antarctic in 1947, and inspired by Captain Robert Falcon Scott.  A British Royal Navy officer and explorer, who led two expeditions to Antarctic, the work was started in 1949, and composition completed in 1952.   The first performance took place on January 14, 1953 in Manchester with Sir John Barbirolli conducting the Hallé Orchestra, and with soprano soloist Margaret Ritchie.  Rafael Kubelík conducting the Chicago Symphony Orchestra gave the first American performance on April 2, 1953.  Sinfonia antartica (“Antarctic Symphony”) is the Italian title given by Vaughan Williams to his seventh symphony.  A typical performance lasts around 45 minutes. There are five movements and Vaughan Williams specified that the third movement lead directly into the fourth. The score includes a brief literary quotation at the start of each movement. They are sometimes spoken or read aloud in performance (and recordings), however, the composer did not specify that quotations were intended to form part of a performance of the work.

1. Prelude: To suffer woes which hope thinks infinite, to forgive wrongs darker than death or night, to defy power which seems omnipotent … Neither to change, nor falter, nor repent: This is to be good, great and joyous, beautiful and free, This is alone life, joy, empire and victory.

2. Scherzo: Moderato: There go the ships, and there is that Leviathan whom thou hast made to take his pastime therein.

3. Landscape: Lento: Ye ice falls!  Ye that from the mountain’s brow a down enormous ravines slope a main — Torrents, methinks, that heard a mighty voice, and stopped at once amid their maddest plunge! Motionless torrents! Silent cataracts!

4. Intermezzo: Andante Sostenuto: Love, all alike, no season knows, nor clime, nor hours, days, months, which are the rags of time.

5. Epilogue: Alla marcia, Moderato (non troppo allegro): I do not regret this journey; we took risks, we knew we took them, things have come out against us, therefore we have no cause for complaint.

‘Hodie’ This Day: A Christmas cantata by Vaughan Williams and was composed between 1953 and 1954.  The cantata, considered his last major choral-orchestral and the work premiered at Worcester Cathedral under Vaughan Williams’ baton.  It was part of the Three Choirs Festival, on September 8, 1954.  The cantata, in 16 movements, scored for chorus, boys’ choir, organ and large orchestra, and features tenor, baritone, and soprano soloists.

Instrumental elements of the orchestra: Three flutes, piccolo, two oboes, cor anglais, two clarinets in B-flat, two bassoons, contrabassoon, four French horns in F, three trumpets in B-Flat, two trombones, bass trombone, tuba; a percussion section that includes timpani, bass drum, snare drum, tenor drum, tubular bells, cymbals, glockenspiel and triangle; celesta, piano, organ; strings; one SATB mixed choir and one boys’ choir; and one soprano soloist, one tenor soloist and one baritone soloist.

Hodie, is considered a synthesis of Vaughan Williams’ entire artistic tenure, utilizing creative motifs from his other works, bible texts, quotes interwoven with poetry, in his cantata. Musically, various movements may suggest kin to different earlier works, unlike many other composers drawing upon their earlier works for inspiration to create new works.  Thematically, Hodie, is bounded together by three thrusts, which recur throughout its length. The first, is heard on the word “Gloria” in the first movement, and recurs when word is introduced again. The other is in the first narration, reappearing at the beginning of the epilogue. The final setting of Milton’ text uses the same melody as the first song for soprano, with different orchestration.

Symphony No 8 in D minor: Composed between 1953 and 1955.  Sir John Barbirolli conducted the premiere on May 2, 1956, with the Hallé Orchestra.  Eugene Ormandy gave the Eighth Symphony its U.S. Premiere with the Philadelphia Orchestra on October 5, 1956.  In 1957 on June 30, Leopold Stokowski conducted Eighth Symphony with the London Symphony Orchestra at the Royal Festival Hall in the presence of the composer.  The Eighth Symphony is the shortest of Vaughan Williams’ nine symphonies, with a performance clocking typically at just under a half hour. The Eighth Symphony is described as remarkably inventive, with the composer’s exploration in sonority.  The work expanded percussion section, along with three tuned gongs.  The primary movements make use of the winds and strings sections, respectively.  The Eighth Symphony like the Fourth symphony ends with a loud conclusion. Much in contrast with all other Vaughan Williams symphonies that have quiet conclusions or diminuendo niente, such was the Vaughan Williams signature.

The symphony is for a large orchestra:
   Woodwinds: 2 flutes (2nd doubling on piccolo), 2 oboes, 2 clarinets (in B♭), 2 bassoons
   Brass: 2 horns (in F), 2 trumpets (in B♭), 3 trombones
   Percussion: timpani, vibraphone, triangle, glockenspiel, side drum, cymbals, tubular bells,
   tuned gongs, bass drum,  xylophone, celesta
   Strings: 2 harps, and strings

The work consists in four movements:
1. Fantasia (Variazioni senza tema
2. Scherzo alla marcia
3. Cavatina
4. Toccata

Symphony No, 9 in E minor: The last symphony composed by Ralph Vaughan Williams. Vaughan Williams composed it from 1956 to 1957. The premiere performance was in London on April 2, 1958, and performed by the Royal Philharmonic Orchestra under the baton of Malcolm Sargent. A programmatic symphony based on Thomas Hardy’ book Tess of the d’Urbervilles. The programmatic elements eventually disappeared as work on the composition progressed, however, existing sketches indicate in the early stages of composition, certain passages associate themselves to specific people and events in the novel.  Ralph Vaughan Williams died four months after the premiere, on August 26, 1958.

The work consists in four movements:
1. Moderato maestoso
2. Andante sostenuto
3. Scherzo: Allegro pesante
4. Finale: Andante tranquillo

Epilogue:

 The music of Ralph Vaughan Williams is like an amalgamation of his musical intellect, internal emotional state, life experiences, and personal relationships.  Ralph Vaughan Williams had a natural gift or an intuitive way of incorporating personal and biographical elements into his creative process of composing classical music; so unique and successful, it became 20th century musical signature.

The third son of Reverend A. V. Williams, whose early death influenced and changed Ralph Vaughan Williams’ life and religious outlook, and for a while, as a young man he was an atheist, later in life as adult became agnostic.  Ralph Vaughan Williams was a complex man, who dealt with extraordinary internal conflicts and ironies, so it is not surprising this agnostic’s life work in music played as instrumental role in helping and organizing people of faith sing and pray.  His work with editing the English Hymnals, working with local church choral groups, and of course such masterpiece works such as,  Five Variants of Dives and Lazarus  and Fantasia on a Theme by Thomas Tallis are not only material evidence but highlights the composer’s deeply spiritual nature and deposition, regardless of his agnosticism.

When it comes to British classical music in the 20th century, composers like Hubert Parry, Charles Villiers Stanford, Edward Elgar, Frederick Delius, Gustav Hoist, John Ireland, Percy Grainger, and Benjamin Britten are among the pillars and standouts of British classical music history. Then there is the unique mark of composer Ralph Vaughan Williams, whose symphonic style captured the minds and imaginations of entire country of England, and then the world.  Ralph Vaughan Williams’ music was not only appreciated in 20th century but his music continues to thrive into the 21st century with orchestras and audiences around the world, of a time, never forgotten.

#RalphVaughanWilliams
Sources:  Ralph Vaughan Williams Society, BBC, and Wikipedia

Dedicated in memory of my Grandfather:
Elighio (Lee) Vicente Peña, Veteran of World War I (France) 1917-1918

All Rights Reserved: Richard Anthony Peña

Posted in 2016 | Tagged , , , , , , , , , , , , , | Comments closed

Theater: Reality, Rituals, and the Human Imagination


Altamira, Spain – Before the Common Era

Perched high on the ledge of the cave wall, small reddish brown bird watches with curiosity from its nest, and observes the outline of twelve silhouettes huddled around a smoky but tender fire.  The smoke from the fire rises, softens the angular light of the sun setting in the distance, as the intense, and rich color of the sunlight mixes with light from the fire, exposing the inside of the cave walls, illuminating with animal drawings of rich ochre yellows, burnt reds, charcoal black lines, and carefully articulated shapes.  Slowly, the group of twelve congregates in half circle in front of their sacred wall of animal drawings, and unlike the static drawings, the evening barn swallows fly in a swirling spiral column in and out of the cave’s opening, filling the cavern with echoes of their songs.  Two of the members from the group begin to animate their arms, body movements, modulate their vocalization, and include the animal drawings into the theater of their making.  Here, at this moment, humans refer to reality of their experiences to form a ritual of an instinctive and intuitive nature to explore the unknown world of the human imagination.

History: The Second Sibling of Reality

Our human DNA has long memory, rich in ritual experience.  The most notable rituals are from the historical records of classical Western civilization where the ritual experience merged into what was the early Greek ritual-theater.  The ritual-theatrical experience was stable discourse, and embraced as tradition in ancient Greek society, as participation was an important part of citizenship of the city-state.  The nature of the ancient Greek theater included many types of social threads, and could be festive, religious, political, musical, poetic, athletic, marriages or funerals.  Theater was part of everyday ancient Greek society’s communion with life, as they understood it.  The hellenization of the theater, and of culture, has had indelible mark over the ages as the theater has since transmuted into rivers and tributaries of imaginative works about the ritual experience, defining the human story, changing cultures, religions, and politics.

In Aristotle’s literary work of Poetics, dramatic theory expanded, and defined the theater to include spectator participation in contrast to the rituals of the sacred mysteries.  In Poetics, Aristotle sets the rules, similarities, and limitations for comedy, tragedy, satyr plays, poetry, and epic poetry.  The Greeks believed that the similarities between the ritual and theater, both brought purification and healing to spectators by means of an imaginative experience.  The Greek poet, Arion, transformed the Greek theater or the dithyramb with the use of literary composition to incorporate the beauty of words into the performance which gave sophistication to the ritual nature of the theater.

Arion, is best remembered for his ability to play the kithara, and as legend has it, he was kidnapped by pirates for his prize money.  The pirates gave Arion two options, to commit suicide, and have a proper burial on land or tossed out into the sea to perish.  Arion gave the pirates’ offer some thought, so he stalled by playing his kithara, and began to singing praises to Apollo, the god of poetry.  The singing attracted many dolphins to the ship, and at the end of his song; Arion threw himself off the ship into the sea rather than to face the certainty of death at the hands of the pirates.  One of the dolphins came up to Arion, and carried him to safety to the sanctuary of Poseidon at Cape Tainaron. At the end of the heroic journey the dolphin sadly expired, and died, but Apollo the god of poetry did not forget the dolphin’s heroic kindness, and gave the dolphin a place in the stars.  Delphinus is a constellation in the northern sky, close to the celestial equator.

Spiritualism or Contempt of Reality

The story of Arion is a myth but yet historically part of the fabric of the human narrative in that many of the elements of the story are not impossible or out of the mathematical probability of occurring.   But here in the story of Arion, as like all imaginative narratives the lines between reality and imagination start to blur, the relationships of reality, and the ritual narratives as interpreted by the human imagination then become synonymous when presented to the recipient through the lens of the past, present, and future tenses.  As humans we are curious by nature, and our imagination may be analytical, convergent, deductive, divergent, destructive or purposeful, and allows humans to deviate from the sphere of the real or empirical worlds into the sphere of the imaginable, in which all things are possible.  The long twisting road of human history is one of many inhumane, cruel, and barbaric episodes; yet, we as humans manage to find opportunities in struggles, and conflicts, to imagine new patterns of human migration, and culturalization that sometimes produces seeds of momentous ideas throughout the human narrative.  Out of conflicts and struggle, the human imagination can overcome the obstacles hindering humans from being free, productive, and contributing to the betterment of all humanity.

Such was the case in the Elizabethan period in which the human imagination produced the power of words capable of painting images.  The distinguished historian Simon Schama cites the birth of the Protestant Reformation, and the changes it brought to Great Britain in the 1500s. The visual imagery and vestiges of Catholicism whitewashed away with the Protestant Reformation transforming the Catholic ritual use of visual imagery into the sacrosanctity of the word, the absolute word of the scriptures.  The human imagination looked for new venues to fulfill the gaps of the missing rich imagery of the Catholic ritual experience with what it knows best, sensory perception, and imagery, restrained during the reformation’s engagement and institution of the Protestant ritual.  As a result, the Elizabethan Catholic ritual experience of imagery transmutes into the development of a new theater of a secular nature, such was the birth of the modern theater.  From this theater, the literary works of Greene, Kyd, Marlowe, and Shakespeare came to life into the flesh invoking images, emotions, and thoughts into our collective imagination, and beyond the world of the theater, forevermore.

Religious rituals and theater of the secular are one of the same when it comes to appropriation of  believers and spectators alike in that each shares more similarities than differences in the art of theatrics but depart, and divide sharply in cultural purposes.  As religion is about socialization, fraternalism, and spiritual order of the individual, where the theater of the secular is more a fleeting, and poetic space, emulating life, and the nature of human character to tell a narrative about human follies or consequences, in rare instances, may reach the level of high art of significant socialization, and cultural change.  Works of Shakespeare and Cervantes are easy reaches.

Yet, the theaters of religion, and of the secular, must both seek an audience for validation; both must compete for their audience’s minds and imaginations.  Here in this reclamation of the spectator’s imagination, the theater in all its all forms, social, political, religious, poetic, and literary uses all the faculties of persuasion at its control to suspend the spectator’s moment of reality with vignettes, sketches, manipulations, replications or retreaded realities.  The human mind knows the differences between real, and what is not but can accept that both can coexist for what they are; which is the mechanism that allows ritual and secular narratives to be plausible, part of the fabric of culture, where one requires faith, while the other requires suspension of reality, or sometimes both.

The mingling of factual circumstances, and imaginable intent can distort the optics of reality, and we can observe it as in social-political propaganda, mass media, television, movies, books, and so on.  The effects can either have calculated risks or unintended consequences, seeping into societies or cultures, mutating the perception of social values, critical thinking, and emotional acumen.  The outcomes can be contemptuous of reality, dangerous, misleading, hurtful, deadly, or life embracing, celebratory, spiritual, heroic, or reciprocal of the entire spectrum of the human imagination in a world that evolves into light and darkness among the heavens and constellations.

Epilogue

The Theater of Machine and Artificial Intelligence

The theater and evolution of technological history is like a red wing black bird flying over the long line of fence posts that run across a pasture with each post representing a new milestone of technological change then disappearing out of view into the distance of the horizon line.  With history at our side, we know technological changes will happen but we do not know when and how technological change will emerge, and what the ethical, and legal ramifications on humanity are.  Today, at least six countries are at the crossroads of significant technological change in the theater of machine and artificial intelligence.  The impact to the rest of the modern, and emerging countries alike will be of a sea change that the world has never witnessed historically.  Machine and artificial intelligence will influence every institution from physical and digital infrastructures like manufacturing, banking, medicine, military, aerospace, and mass media.  The human imagination resides in all tenses, past, present, and the future but the most intriguing are the imaginative sensibilities that lie in the future tense.

Autonomous not Anonymous  

Everybody wants to rule the future but let us hope Google (Alphabet) lives up to its unofficial motto, ‘don’t be evil’ as one of, if not the most technological powerful entities shaping the future.  Google is spending its billions on the theater of the future; putting its money to work from gathering social data to machine and artificial intelligence to deep learning, through tactical triangulation, and Return on the Future to define their stake, and place forward.  The road forward so far with Google’s investment in autonomous automobiles is led by Sebastian Thrun, former director of the Stanford Artificial Intelligence Laboratory.  This is the start of the next technological revolution but do not be fooled, it is not so much about Google’s Chauffeur future concept car but the rich intellectual capitalism of patents of machine source codes and algorithms.

The predictive data suggest that autonomous technology introduction into the markets will evolve more quickly as more players such as Apple, Google, Tesla, and Uber, enter the machine and artificial intelligence space.  This is more than just another trend in that some of the brightest artificial intelligence talent have migrated to the private sector as the likes of Regina Dugan of Google, and Gill Pratt of Toyota with the ambitions to continue the development of the theater of machine and artificial intelligence.  The largest automobile maker, Toyota has recently announced U.S. $50 million R&D Artificial Intelligence collaboration with Stanford and MIT.  It is true that some polls portray a skeptical public, and outlook about autonomous technology with some research suggesting that about twenty percent of the population in the U.S. is fearful of artificial intelligence.

Nonetheless, autonomous technology and automobiles will happen.  The first phase will not be fully autonomous but most industry experts agree in building a safety framework around autonomous machines and artificial intelligence to augment enhanced automobile safety will be the first required step forward.  This safety framework will be the key for obvious reasons, in that new federal and state regulations must be developed, and rendered to necessitate a regulatory foundation on behalf of autonomous industry, and the public trust.  California has already begun autonomous machine legislation, and mostly likely will serve as the model of such legislative framework for the rest of the nation.  There are still the unfinished business of early adopter’s acceptance, product liability, and risks assessments requirements, before autonomous automobiles can go to market, but nonetheless, your children’s children will inherit an autonomous future only now imaginable.

The Theater of Warfare

The first shot of the electronic technological war was not a weapon but an artificial satellite named Sputnik.  In 1958, President Eisenhower created DARPA, Defense Advanced Research Projects Agency, with the purpose of expanding the frontiers of technology, and science.  DARPA has a more serious role in the Artificial Intelligence with security, defense, and warfare in mind.  So serious in fact are the efforts, and scientific accomplishments, it has prompted the likes of Stephen Hawking, Bill Gates, Elon Musk, Steve Wozniak, in signing an open letter calling for a ban on offensive autonomous weapons.  Warfare and intelligence gathering will never be the same again, more computational, and predictive then logistical.  The Pentagon has a long historical involvement with advanced technology, and is no stranger to the digital age.

Earlier this year, CIA Director John Brennan, announced a major reorganization to embrace the digital age.  Brennan is creating a fifth directorate, the Directorate of Digital Innovation, which will focus on the new world of computer networks.  Now changing the way in which intelligence gathering is conducted with digital sensing, staging, and appropriation.  Imagine digital teams having the ability disrupt both digital, and physical infrastructures, creating selective disinformation, accessing, and tagging targets, using disruptive bots, viruses, micro-robotics, performing digital swarming, creating honeypots, using both digital and physical brute force strategies, and all augmented programmatically by source code as cyber warfare.  Warfare has, and will always include human side of diplomacy but staging in the future warfare will be programmatic, computational, still thematic, but scalable, than logistical, with concepts like super computing analyses, behavioral science, deep learning, and digital delivery with little human intervention, other than specialization.

The Terminator concept is not far from becoming a reality in the theater of warfare; expect to see more highly advanced propelled stealth robotics that can quickly take an offensive position, and easily adapt by air, sea, and rough terrain, remotely programmable controlled with precision in neutralizing targets while keeping soldiers and civilians safer. Research and development platforms are currently investigating both source code, and electro-mechanical engineering to develop robotic that can learn, and understand behavior science.  Concurrently, there is research to investigate if artificial intelligent machines or networks programmed to protect it from being deprogrammed, can indeed be deprogrammed.

DARPA is intellectually rich, and with a deep portfolio.  Here are few of the publicly known projects; Atlas Project-Humanoid, Remote-Controlled Insects, Mind’s Eye Project, and there are many more technological advanced systems to numerous to list but point made.  Here is our future tense, where the human imagination forges a path with the most eloquent technology of demise will evolve into the ritual and theater of warfare.  Only in the human imagination, can such eloquent, and deadly machines evolve, and transpire in a way that only Leonardo da Vinci could appreciate, and Francisco Goya could despise as historical references of the collective consciousness of the technology of warfare, and humanity.

The Theater of Healing and Medicine

The theater of healing arts has a long path back in the human story.  The human imagination has almost been fascinated with the nature of healing as long as human’s fascination with the supernatural, spiritual, and afterlife, as such power to heal, resolve or manage diseases, injuries, wounds, dislocations, tumors, and perform surgeries are gifts unparalleled, and extraordinary acts of the human imagination.  To make a comparative contrast between the theater of healing and medicine it is important to make the distinction of healing as pseudo scientific, and medicine as scientific, as this epilogue will survey the past as it relates to future of the theater of medicine.  The oldest cultures to delve into the ritual of healing began with the early Egyptians, Babylonians, Indians (India), Chinese, and Greeks, here in the past tense lays our basis, history, and imagination of the healing.

The Egyptians introduced healing as a practical art as early as 3000 BCE.   The earliest recorded surgery was in 2750 BCE.   Most of the information we know about the Egyptian’s knowledge about healing comes from the medical treatise known as the Edwin Smith Papyrus, named after the antiquity dealer who bought the Egyptian artifact.  The document describes the details of 48 cases of injuries, fractures, wounds, dislocations, tumors, and surgeries.  Mainly focuses on surgery and trauma detailing patient’s cases with the type of the injury, examination of the patient, diagnosis, prognosis, and treatment.  The Kahun Gynaecological Papyrus is the oldest medical description of any kind, and specifically focusing on women’s medical complaints and treatments.

The oldest Babylonian texts on healing date back to the first half of the second millennium BCE.  The most extensive Babylonian medical text is the Diagnostic Handbook written by the ummânū, who was the chief scholar of the Babylonian King Adad apla iddina between 1069–1046 BCE.  The Babylonians, as the Egyptians used the same logical approach to healing as they too, practice of use of diagnosis, prognosis, physical examination, and remedies.  The Diagnostic Handbook was an in depth logical set of clinical rules and assumptions based on the patient examination and inspection as they relate to patient’s complaints.

The Indian tradition of early healing practices can be characterized using of empirical thought, and along with imagination in that early Indian healing concepts dealt with both logical observations, and magic. The Susruta Samhita, written by Sushruta, and dates back to the period of 6th century BCE.  This text is distinguished for describing procedures on various forms of surgery, and procedures.  Notable for scientific classification as the medical treatise consists of 184 chapters, 1,120 conditions, including injuries, illnesses relating to aging, and mental illness.  The Sushruta Samhita describes 125 surgical instruments, 300 surgical procedures, and classifies human surgery in eight categories.  It is one of the foundational texts of Ayurveda healing along with its eight branches.

Traditional Chinese medicine consists of a broad range of healing practices developed over 2,000 years ago, with various forms of herbal medicine, acupuncture, massage, exercise, and dietary therapies.  The historical traces of therapeutic activities in China date from the Shang dynasty during the 11th and 14th centuries BCE.  Many of the traditional Chinese healing concepts are imagination based such as the concept of vital energy channeled through meridians, which is not proven by logical observations or scientific methods but philosophical in approach.  There was not much emphasis place on the anatomical structures but on breathing, digestion, and aging.  Traditional Chinese approach would to measure the pulse, inspection of tongue, skin, and eyes.  Investigate eating and sleeping habits of the patient, and look for attributes of disharmony.

The European Western tradition of healing like theater traces back to early Greeks.  An early account of the theater of healing comes from the ancient epic Greek poem by Homer, The Iliad, where Eurypylus asks Patroclus,“to cut out this arrow from my thigh, wash off the blood with warm water, and spread soothing ointment on the wound.”  The Greeks created temples of healing, and such were dedicated to the healer god Asclepius.  These healing temples known as Asclepieia, became centers of medical advice, prognosis, and healing for the early Greeks.  Patients seeking treatment would be induced into a sleep like state by sleep inducing substances.  Patients would ask for help from their deity or if required have surgery in the Asclepieia while in a dream like state.

In the Asclepieion of Epidaurus, preserved are the names, case histories, complaints, and cures of patients.  Surgical details are as the opening of an abdominal abscess or the removal of traumatic foreign material date back to 350 BCE.  The first known Greek medical school opened in Cnidus in 700 BCE.  The theater of the healing would not be complete without Hippocrates of Kos, considered the father of Western medicine, and the first to describe many diseases such as lung and heart diseases with their symptoms.  Hippocrates also created much of the terminology or language around illnesses such as acute, chronic, endemic, epidemic, exacerbation, relapse, resolution, crisis, paroxysm, peak, and convalescence.  Many of the findings of Hippocrates are still valid today from pulmonary medicine to surgery to the Hippocratic Oath.

Throughout the ages, the theater of healing has progressed tremendously, and has transformed into the science of medicine in all its forms such as in investigations, classifications, and implementations of managing diseases, illnesses, and trauma.   The future of the theater of medicine will transition from human-based findings of science to technological-based science of precision medicine.   From all the lessons of the past, the future of the theater of medicine will accumulate the physical, material, and biological sciences with the computer sciences as never before outcomes such as of advanced rDNA technology, 3-D Bio Printing, transfer, and surgical precision implants on a cellular molecular scale.

To gain a glimpse of the future theater of medicine, the work of Dr. Patrick Soon-Shiong, the Los Angeles based surgeon, physician, medical researcher, and business executive is one of medicine’s leading innovators, at best, his work is a vignette of the future.  To get an idea of Soon-Shiong penchant for innovation, Soon-Shiong performed the world’s first full pancreas transplant in 1987.  He invented the nation’s first FDA approved protein nanoparticle delivery technology for the treatment of metastatic breast cancer, improving the in patients’ response rate.  His resources to innovate come from in that he has successfully developed, and sold two multi-billion dollar pharmaceutical companies, American Pharma Partners and Abraxis BioScience.  Soon-Shiong’s current companies are NantHealth and NantWorks, started in 2007 and 2011. Both companies utilize a number of IT technologies such as fiber-optic, cloud-based data infrastructure to share healthcare information.  Three years ago, Soon- Shiong announced NantHealth’s supercomputer-based system, and network are able to analyze the genetic data from tumor samplings.  The intent of developing such infrastructure, and digital technologies are to share the genomic information among sequencing centers, medical research hubs, hospitals, and advanced cancer research.  Soon-Shiong had Blackberry build the first DNA browser based on his design, and data requirements.

Expect in the future advanced DNA (Deoxyribonucleic acid) and rDNA (recombinant Deoxyribonucleic acid) technology to help augment patient’s family histories of diseases, and most important help determine the most effective use of pharma therapy to treat a diseases.  Today pharmaceutical companies are working closely with DNA,  rDNA, and 3-D Bio Printing research companies to beta test drugs, and pharmaceutical efficacy.  The goal is to determine the effectiveness of drugs, the patient’s response to drug therapy based on specific discrete DNA sequencing, and mutations.  Mutations or SNPs are in essence, signatures or fingerprints of who we are, and such mutation markers become created along the way during our historic lineage over time.  The patient’s genome map will help determine what drugs to use with more precision based on such research, and this type outcome becomes paramount with the population of patients with very short cycle times with terminal diseases.  The theater of medicine will become synonymous with input, signal processing, and output as time goes on.  The medical establishment will transition to more centralized hubs and spokes, to embrace technological and economic change of advanced medical input capture technology, signal analytics, and precision output plans with the outcome of the next stage of medicine, the technological science of predictive health.

Imaginable Rituals

Although as humans, we cannot escape our ritual past or counteract the future, as like our ancient ancestors of the past, we embrace our collective imagination to create, and live in the theaters of our making.  Now in this age, and time, we as humans refer to reality of our experiences to form a technological ritual of an instinctive and intuitive nature to explore the unknown world of the human imagination, such an earthly sphere of luminous light amongst veiled shadows of human capacity.

#RitualTheater

All Rights Reserved  © Richard Anthony Peña 2015

Posted in Theater | Tagged , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , | Comments closed

Beethoven and the Revolution


It was time, not the time kept by a clock or pocket watch but time kept by eternity.  Underneath the landscape’s horizon line the hills and valleys around Vienna appeared like a soft romanticized painting with rich greens, golden brownish reds and luminous beige hues, speckled with bare trees anticipating the touch of the sun.  The stormy grey skies of March seemed somber with winter’s last hold before the changing of the seasons from winter into spring; the sobriety of the coldness of winter mixed with the longing of warmer days to come along with the blossoms of early spring flowers.  Such was the feeling in Vienna in the late winter of 1827, and indeed seasonal change was in the air.  A young lady riding in a carriage was overheard describing the change in seasons like the transition between symphonic movements.  It was the kind of change that all of God’s creatures on earth intuitively know, the seasonal life cycle; the entry of newborns into the world and the passing of the living inflected by age, sickness or fate into finality of silence.

Vienna on March 26, 1827, the morning air was still and calm, sweeten with dust from the fields mixed with moisture in the air that created a kind of earthy fragrance.  Dark and towering pillars of thunderstorm clouds began to build outside of town and then slowly marched in like French revolutionary guard ready to battle over the souls of Vienna.  The rumbling of thunder could be heard in the distant from Beethoven’s room.  Beethoven was in immense discomfort and had taken a turn for the worst.  Days before Dr. Wawruch performed a common medical procedure on Beethoven to relieve the swelling of the stomach by puncturing the abdomen to remove the excess liquid.  One of the four puncture wounds became infected.

There laid Beethoven in his deathbed, the man who inspired his generation and generations to come, suffering, in immense human discomfort and pain, cast in silence from his deafness.  Nearly alone spiritually.  Only two people and God were present and witnessed Beethoven’s death.  To this day, it is still unclear to scholars of the final passing of Beethoven and if he had last words, if any, but lore.  We are only left with our imagination; as the lighting and thunder from the storm approached closer, the flashes of light and thunderous rumble of vibrations drew Beethoven further inward, remembering the instances from his life with each flash of lighting illuminating his room, then slipping away as the thunder rumbles away into silence and the vibrations into stillness.  Ludwig Van Beethoven died on March 26, 1827. Three days later, Beethoven’s funeral procession marched through Vienna attended by twenty thousand people to pay tribute to this heroic figure.

The Flame

Long before Beethoven was born, a flame flickered in the Age of Enlightenment and which later grew into revolutionary and intellectual fire in the 18th and late 19th centuries, in that European cultural and intellectual thought emphasized reason, analysis, and individualism rather than the age old lines of authority based on ancient and feudal power structures. The light from the flame of enlightenment came the writings of Bacon, Descartes, Hume, Kant, Locke, Mendelssohn, Newton and Voltaire to name more than a few and such thoughts inspired both the American and French Revolution’s ambitions to set men free from the chains of a feudal caste system.  While the American Revolution from the start became a shining light of the world, the French Revolution became a digression into terror and then Bonaparte.  In spite of this historic French digression, French society and culture changed, forever.  French society progressed forward since the days of the French Revolution’s Declaration of the Rights of Man and of the Citizen, Napoleonic Code and established Constitution.  Now France is considered one of the shining lights of the modern and free world.  However, the fight against the chains of political tyranny and corruption, religious intolerance and terror, racism and cultural discord, misogyny, poverty, disease, crime and injustice still continues around the world and the flame still burns.

The Artist as Hero

Ludwig (Luigi, Louis) van Beethoven was baptized on the 17th of December 1770 in Bonn, Germany of the Holy Roman Empire.  His parents were Johann van Beethoven and Maria Magdalena Keverich.  Beethoven was fortunate to have a mother like Maria.  Beethoven described her as, ‘kind, loving mother to me, and my best friend’.  Maria was a genteel, serious, and deeply moralistic woman and it is her values which formed Beethoven’s world view on life and music.  Beethoven witness his mother’s sorrows in marriage and she suffered dearly from a dreadful bloody disease.  Maria died at the age of 40 of consumption on 17th of July 1787.

Beethoven’s father, Johann came from Flemish stock as van in his name indicates, as the Beethoven men were proud of their Flemish heritage.  Johann van Beethoven was considered a mediocre court singer with a reputation as an alcoholic more so than having musical ability or talent.  However, Beethoven’s grandfather, godfather and namesake, Kapellmeister Ludwig van Beethoven, was Bonn’s most prosperous and eminent musician, a source of endless pride for Beethoven.  It is true, Johann taught his son to play the piano but from all accounts, he was brutal, cruel, and violently dogmatic in his methods that it effected and changed Beethoven for the rest of his life.  Johann attempted to provide for his family but descended into the despair and lost himself in alcoholism to the point of being an incapable soul.

If Mozart is considered the child prodigy, the boy genius, mentored by his father Leopold Mozart and Papa Joseph Haydn, then Beethoven is the artist’s hero, brooding, challenged, confident, and imaginative innovator.  Beethoven as a child was not a prodigy nor mentored musically by his father but one can say he was indeed disciplined in music.  Beethoven was mentored by Christian Gottlob Neefe in Bonn and Johann Georg Albrechtsberger, Antonio Salieri, Joseph Haydn in Vienna.  However, his relationship with Haydn, who was considered the best composer in Vienna at the time, was short, perhaps of the differences in personality and chemistry.  Although the aristocratic class of Vienna as of the likes of Count Waldstein, Prince Lobkowitz, Prince Lichnowsky and Baron Gottfried van Swieten accepted Beethoven socially, in fact, it was their patronage that enabled Haydn, Mozart and Beethoven for the betterment of Vienna as the center of music in Europe.

Beethoven was never a servant to the high born.  He held the deposition that the artist is equal in nobility as the high born in that the artist’s gift of creativity ennobles all of humanity, regardless of the artist’s social caste, therefore, is noble in the truest sense of the word.  In the values instilled in him by his mother, Beethoven believed music moralistic imperative was to lift the human spirit from the evil and darkness into the divine and light.  Beethoven succeed in his art against all odds that life and God laid before him, wrestling with the angels and demons to eventually write Symphony No. 9 D Major completely without the ability to physically hear a note.  The heir apparent to Mozart, Beethoven single handedly expanded the symphony to new heights and bridged the Classical and Romantic periods in music while carrying the crescendo of the enlightenment.

Genesis of the Eroica Symphony

Like all works of creative expression have an uncanny way to imprint and present the artist’s psychological self-portrait to the observer.  Beethoven’s art is a true self-portrait, his use of the musical language paints his emotions and expresses the joys and sorrows in a way that every human can relate to in universal time, so goes Rembrandt, so does Beethoven.  When Beethoven expanded the tradition of Haydn and Mozart, he stated he was not satisfied with his work thus far and needed to take a new path through the woods.  At the turn of the 18th century, Beethoven could not escape the revolutionary flames in politics or the grand ideas of the time nor could he reconcile the internal conflicts of his personal life.  Beethoven had been an admirer of Napoleon Bonaparte and there was great enthusiasm throughout Europe in the hope the old ways of governance would collapse.  Napoleon appeared to championed the cause.  Beethoven became enraged when he learned of Napoleon’s true intentions and declared himself Emperor.

From Biographische Notizen über Beethoven, F. Wegeler and F. Ries, 1838:  

In writing this symphony Beethoven had been thinking of Buonaparte, but Buonaparte while he was First Consul.  At that time Beethoven had the highest esteem for him and compared him to the greatest consuls of ancient Rome.  Not only I, but many of Beethoven’s closer friends, saw this symphony on his table, beautifully copied in manuscript, with the word “Buonaparte” inscribed at the very top of the title-page and “Luigi van Beethoven” at the very bottom.  Whether or how the intervening gap was to be filled out I do not know.  I was the first to tell him the news that Buonaparte had declared himself Emperor, whereupon he broke into a rage and exclaimed, “So he is no more than a common mortal!  Now, he too will tread under foot all the rights of man, indulge only his ambition; now he will think himself superior to all men, become a tyrant!”  Beethoven went to the table, seized the top of the title-page, tore it in half and threw it on the floor.  The page was later recopied and it was only now that the symphony received the title ‘Sinfonia Eroica.’  

Heiligenstadt Testament

Beethoven was troubled about his financial future, commoner status, ability to marry and above all his health was frightening him.  In the late 1790s Beethoven started to hear the ringing and buzzing in his ears.  In 1801 and 1802, he sought consultation of a new physician, Johann Schmidt, which the recommendation was given to take some rest away from Vienna.  Beethoven decided on a restful place on the outskirts of Vienna in the village of Heiligenstadt.  His time in Heiligenstadt gave him the rest he needed but his ability to hear was deteriorating further.  One can only imagine the thoughts and emotions running through Beethoven’s head.  In the autumn of that year he was compelled to draft of his last will and testament.  This document came to be known as the Heiligenstadt Testament.  The document is considered a confessional and psychological record of Beethoven’s state of mind, he writes in length of his illnesses, reveals that he has contemplated suicide to overcome the pain and despondency of the illness that haunts him but his art keeps him from taking his life.  Beethoven kept this document hidden for the rest of his life and it was never revealed to anyone until after his death.  The document has been linked to the creation of the Eroica Symphony because it gives an explanation of Beethoven’s psychological state and why his compositional style changes so drastically.  Some scholars have noted both the Heiligenstadt Testament and Eroica Symphony are indeed linked confessional documents; recognizable moments of truth.

Symphony No. 3 in E-Flat Major “Eroica”, Op. 55

Beethoven completed the composition in early 1803 and the first public performance of Symphony No. 3 in E Flat Major was on 7 April 1805 in Vienna.  The innovative work of Eroica expanded the scale of the symphony on many levels, exposition, development, recapitulation, and coda became reapportioned to equivalent scope, specifically the development and coda; a departure from Haydn and Mozart.  Beethoven expand the sonata form as never before.  For the first time three horns are used in symphony.  Although like most masterpieces, at first, there are divided opinions on the merits of the work and some critics praised it was a masterpiece while other critics of the day attacked the length of the symphony as being exhausting, disjointed, and lacks rounding out.  After 210 years, the Eroicia Symphony has heroically endured as one of the most innovating, exciting, challenging symphonic works recognized and accepted as an important turning point in music with considerable historical, political, and biographical optics.

The Four Movements:
Allegro Con Brio (Heroic Life)
Marcia Funebre adagio assai (Death, Sorrow and Realization)
Scherzo Allegro Vivace (Resurrection of the Hero and Humility)
Finale Allegro Molto (Hope and Triumph)

Beethoven’s Eroica Symphony  “Ever thine, Ever mine, Ever ours”

#BeethovenRevolution

All Rights Reserved  © Richard A. Peña 2015

 

Posted in Beethoven | Tagged , , , , , , , , , | Leave a comment

Abstractions – Sketches in Organic Unity


Book Review:

Title: Abstractions – Sketches in Organic Unity
Book Release Date: July 2015.
Dimensions: Large Format Landscape Book and eBook, 28 Plates, 58 Pages.

The concept of the book continues to extend the explorations and findings from the series Flora Nocturne.  Specifically focusing on the abstract, unreal and imagination of form itself.  While organic forms can be beautiful and powerful, the nature and investigation of Abstractions – Sketches in Organic Unity, is purely visual and imaginative.  Simply reverting back to essence of mark making, where line quality, texture, color field, and luminescence can invoke a wide range of emotional triggers and cognitive relationships to space within two-dimensions.  The book is available in both in a tradition hard/soft cover formats and e-book.  Ultimately, only seven out of twenty eight images will be selected for suite of large format chamber prints on high quality 100% cotton textured substrate.


All Rights Reserved © Richard A. Peña 2015

Posted in Book Release | Tagged , , , , , , | Leave a comment

Digital Panopticon


Arestor looked down at his newly born son with wonder, and with fatherly pride.  As for his new born son was beyond the size of any human baby imaginable.  Arestor wiped all the tears from his son’s crying eyes, all one hundred of them and decreed to all, from here forth, my son will be called Argus Panoptes. Hear me now, he shall be the greatest watchman of all of Argos, and for all ages.

Panoptes comes from Greek mythology and translates to, the all seeing.  Argus Panoptes was a giant of a man born with a hundred eyes, not two.  Panoptes was a great watchman, and observer of all things, as in that some of his eyes would close to sleep while the other eyes would always remain open, awake, watching, observing and always seeing.   He was the watchful brother of his sister, the nymph Io, and the servant of Hera, the wife of Zeus.  In the end, he was a victim of Hermes’s deadly trickery.  To commemorate her faithful watchman, Hera had the hundred eyes of Argus Panoptes preserved forever, in a peacock’s tail.

The English philosopher and social theorist Jeremy Bentham in the late 18th century conceived of an architectural design, Panopticon.  The name of the architectural design is in reference to Panoptes of Greek mythology.  The design allows a single watchman to observe occupants of an institution without the occupants being able to tell whether or not they are being watched.  Although it is impossible for a single watchman to observe all the occupants at once, it did establish a effective social behaviorism that all of the occupants acted as they are being watched at all times, in essence, the occupants constantly controlled their behavior within the environment.

The symmetrical notion of the observer and the observed has long been an idea of antiquity but more ever so relevant in the digital age, and modern life.  Almost every human interaction with digital technology require some level of authentication of either one’s surrogate identity or demographic identity, whether it is billing accounts, social media, credit cards or mobile devices, we live in a constant ebb and flow of, “to authenticate” or “to be authorized.”   Welcome to the Digital Panopticon my friends, leave your libertarian credentials behind, now your manila folders of John Q. PUBLIC and Jane Q. PUBLIC are now a binary data set.

The benefits and convenience of the Digital Panopticon are indeed addicting and necessary to participate in the modern digital world but there is a price to be paid, which is the currency of your privacy.  Never mind about being worried about being physically chipped, a soft chip will do and it is mostly under control with watchful eyes.  Your surrogate information with be tracked, and in some cases your demographic identity will be stored in secured databases.

So it should come to no surprise that the mass-media analytics are the most successful purveyor of demographics and market data, first with advent of  newspapers, radio, television, internet and now the digital age.  The old economy was ZIP code demographic analytics but today it includes Nielsen digital-on-line analytics in defining who you are in demographic terms, real time, GPS and worldwide.

Perhaps the most intrusive but legitimate Panoptes of mass-privacy are Facebook, Google, Twitter and the makers of smart devices.  Every aspect of these Panoptes seek, observe, and measure who you are by your online habitual disposition.  Read their privacy and data policies.  Of course there is the other kind of Panoptes to beware of, in that their nature can be illegitimate, cowardly, political and socially nefarious.  With a criminal disposition targeted towards the privacy of individuals to disrupt the integrity to authenticate individuality within the bureaucracy state, enterprises, and institutions.

Sometimes illegitimate and nefarious entities use hundreds of eyes or bots to see and crawl throughout the websphere to target their disruptive end to privacy, and individual freedoms.  Such is the hidden and veiled darkness of the world wide web.  Along with the cover of darkness, Tor ‘onion router’ networks are sometimes used by sophisticated intelligence, state, political, organized crime, and hackers, to avoid electronic traffic fingerprinting, and the transparency of their electronic identity.

It is also necessary for segments of the global populations living under repressive regimes to use Tor networks to conceal their web privacy from electronic surveillance exposing internet content deemed social or politically subversive, and to hide the locations of the hosts, and nodes.  Nonetheless, what is most important to all Panoptes of the world is the future to come.

Population Shifts:  
The world population by 2027 will reach 8 billion. Currently 54% world’s growth is occurring mostly in urban areas.  66% of the world’s population will live in urban areas by 2050.  By 2050, the urban population in the developing world will top 5 billion with 1 billion of that will come from Africa, rising from 13% to 20% of the world’s population.

Digital Life:
Nearly 3 billion people are currently online, which is 40% of the world’s population.  80% of Twitter and Facebook activity is happening outside of the U.S.  More than 1.35 billion people log into Facebook each month.  500 million tweets are sent per day.  71% of global consumers own a SmartPhone.  85% of U.S consumers use a mobile device while watching TV.  The world’s largest mobile payment company processes 45 million transaction daily.

Social Mobility:
By 2030 2 billion people will join the middle class.  In Africa and the Middle East the middle class is projected to double and in Asia will rise to 3 billion.  In the next 4 years women will control US $28 trillion in annual consumer spending.

The next phase of digital life will result in instinctive, creative, and destructive processes, such are the fabric of change, as adaptation becomes the ways and means of both natural and disruptive selections.  In a nutshell, digital life or the Digital Panopticon will be catalyst for future social, political, and economic changes to come.

Essentially, the future of both physical and digital communities will be more urban, more digitally connected and synchronous, with a segment of the population growing with middle class affluence.  But see through the digital midway distractions as the growing technological loss of our privacy is like the troublesome bite of the gadfly that we must not ignore.

#DigitalPanopticon

All Rights Reserved  © Richard A. Peña 2015

Statistical Sources: Nielsen, Harvard Business Review, Forbes, Twitter, UN and Facebook

 

Posted in Digital Panopticon | Tagged , , , , , , , | Leave a comment

The Rite of Spring 1913


The Adoration of the Earth:
Introduction
Augurs of Spring
Ritual of Abduction
Spring Rounds
Ritual of the Rival Tribes
Procession of the Sage: The Sage
Dance of the Earth

The Sacrifice:
Introduction
Mystic Circles of the Young Girls
Glorification of the Chosen One
Evocation of the Ancestors
Ritual Action of the Ancestors
Sacrificial Dance

It was cool Parisian evening walk down the Avenue Montaigne to Théâtre des Champs-Élysées that only a Russian like Diaghilev could appreciate.  In 1913, Paris season of Sergei Diaghilev’s Ballets Russes company gave birth to truly the modern.  It was a night that the world changed and never turned back. The Rite of Spring not only changed the Classical worlds of dance and music but it was more than that, it seemed to call out the source of our anthropologic primitive heritage and notions why humans dance along with the inner pulse of our basic communal instincts and rituals.  As like Stravinsky and Nijinsky, channeled the primitive impulses, and then translated the code into new time and space signatures for the inhabitants of the modern world.

The conceptualization of the Rite of Spring was a journey that begun in 1908 with Stravinsky setting to music two poems from Sergey Gorodetsky’s collection “Yar”.  Another poem in the anthology that may have influenced Stravinsky, is “Yarila”.  Many of the elements in Yarila were similar to Rite of Spring.  In his 1936 autobiography Stravinsky described the origin of the work in 1910, “I had a fleeting vision that came to me as a complete surprise.  I saw in my imagination a solemn pagan rite with sage elders, seated in a circle, watching a young girl dance herself to death. They were sacrificing her to propitiate the god of Spring.  Such was the theme of the Sacre du Printemps”.  It was when Stravinsky collaborated with Nicholas Roerich, the foremost Russian expert on folk art and ancient rituals in which the ideas for Rite of Spring started to solidify.  Roerich was known as an artist and mystic and provided the set and costume design for the Rite of Spring.

Vaslav Nijinsky was born in Russia to ethnically Polish parents, both were dancers.  In 1900, Nijinsky joined the Imperial Ballet School in which he excelled and was recognized early on for his dancing abilities.  When Nijinsky joined the Ballets Russes it proved to be a turning point in his career. The Ballets Russes gave him the opportunity to use all of his creative ability as a dancer and most important his impact as a choreographer.  His ballets of notable accomplishments were L’après-midi d’un faune (The Afternoon of a Faun), based on Claude Debussy’s Prélude à l’après-midi d’un faune (1912), Jeux (1913), Till Eulenspiegel (1916) and Le Sacre du Printemps (The Rite of Spring, with music by Igor Stravinsky) (1913).

Igor Stravinsky was born in Saint Petersburg, Russia and also of Polish linage. His father was Fyodor Stravinsky, a bass singer at the Mariinsky Theatre in St. Petersburg.  Stravinsky studied piano and music theory as a young boy but was not considered an exceptional talent.  It was until he met and studied with Nikolai Rimsky-Korsakov later in life as an adult that his talent was developed.   Stravinsky continued lessons with Rimsky-Korsakov until 1908, the year of Rimsky-Korsakov ‘s death.  In 1909, Stravinsky received his first notable commission.  It was at this time Diaghilev was sufficiently impressed by Stravinsky’s work on Fireworks which prompted Diaghilev to commission Stravinsky to perform some orchestrations that led to compose a full-length ballet score, The Firebird (1910) then followed by Petrushka (1911) and The Rite of Spring (1913).  These three ballet scores are perhaps Stravinsky most notable symphonic  works.

Since that faithful evening of May 29th, 1913, Stravinsky’s Rite of Spring now has taken its place as a standard symphonic master piece which never has been rivaled.  As for Nijinsky he leaves us with a legacy of a haunting and brilliant passage of the poetics of form and space, in the art form we call dance. One can only imagine Nijinsky’s creative courage and vision to choreograph Stravinsky’s time signatures where there was no historical references, count or form in ballet. The choreography Nijinsky developed in the Rite of Spring became the foundation of modern dance and gave birth to choreographers as the likes of Martha Graham to Pina Bausch to Hofesh Shechter.

Hundred and two years later Sergei Diaghilev, Igor Stravinsky, Vaslav Nijinsky, Marie Rambert and Nicholas Roerich are still triumphal in telling the story about of our ancient pagan ancestors and their driven instinctive nature for social rituals; the belief that terrible destructive and creative forces of nature must renew its self in order to create the fabric of change, beauty and adaptation to life itself.  Events such as death we cannot escape or completely comprehend.  What we do know about the past and human mortality, scientifically, human genetic markers can trace our existence and traits thousands of years back in time to haplogroups made up of ancient clans or tribes that gave birth to our ritual heritage.  Such an indelible mark is the Rite of Spring.

All Rights Reserved: Richard A. Peña 2015  (except embedded YouTube Video of Millicent Hodson 1987 reconstruction)

 

Posted in Rite of Spring 1913 | Tagged , , , | Leave a comment

Connecting 2014 to 2015


Happy New Year 2015 to Family, Friends and Everyone

Flora Nocturne is a self-published book and was released in June 2014. The category is Fine Art Photography and the book dimensions are Large Format Landscape with 92 pages.           

Tags: Flora, Nocturne, Abstractions, Light.

Book Review:
Flora Nocturne is an analysis that compares and contrasts two visual constructs; objective poetic transformation and abstraction. Objective poetic transformation is not a new idea and derives from photographic statements and criticism from the twentieth century. Practitioners from Alfred Stieglitz to Edward Weston to Minor White were pursuant of purity, objective observations and gateways. The construct of abstractions came from painting and influenced not only photography but the art world as a whole in the twentieth century. The theme of this collection explores the tension between representation and abstraction, real and unreal, reality and imagination, leaving the viewers to question, reconcile, and manifest.

Books in Queue:

Abstractions – Sketches in Organic Unity is the next book to be published with a target release of Spring of 2015.  The concept of the working book continues to extend the explorations and findings from Flora Nocturne but specifically focusing on the abstract, unreal and imagination of form itself.  Organic forms can be beautiful but powerful and can invoke a wide range of cognitive triggers and relationships.

Panorama is the working title for a series of fifty photographic images to be self-published and will be released sometime in 2015.  So far nine out of fifty have been completed to date.  Prints also will also be available with an image size of 8 x 20 (20.3 x 50.8 cm).

Mobile Phone Photography; a series of one offs – The Beauty of Transponding

Prints from these portfolios and website are made with high quality archival color inks and German-made archival substrate.  Please feel free to contact me for details.

Again wishing everyone a Happy New Year and all the best in 2015, Auld Lang Syne

Richard A. Peña

Posted in 2014 | Tagged , , , , , , | Leave a comment